Incidental Mutation 'R6956:H2-T3'
ID 541480
Institutional Source Beutler Lab
Gene Symbol H2-T3
Ensembl Gene ENSMUSG00000054128
Gene Name histocompatibility 2, T region locus 3
Synonyms TL, H2-Tw3, H-2T3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 36185572-36190287 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36189371 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 144 (Y144F)
Ref Sequence ENSEMBL: ENSMUSP00000134469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025312] [ENSMUST00000095300] [ENSMUST00000097329] [ENSMUST00000102675] [ENSMUST00000172663] [ENSMUST00000173133] [ENSMUST00000173629] [ENSMUST00000174101]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025312
SMART Domains Protein: ENSMUSP00000025312
Gene: ENSMUSG00000054128

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 120 2.5e-40 PFAM
Pfam:MHC_I 114 161 3.7e-14 PFAM
IGc1 180 251 1.6e-20 SMART
transmembrane domain 271 290 N/A INTRINSIC
low complexity region 293 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095300
Predicted Effect probably benign
Transcript: ENSMUST00000097329
SMART Domains Protein: ENSMUSP00000138177
Gene: ENSMUSG00000054128

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102675
AA Change: Y144F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099736
Gene: ENSMUSG00000054128
AA Change: Y144F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 205 9.3e-85 PFAM
IGc1 224 295 1.6e-20 SMART
transmembrane domain 315 334 N/A INTRINSIC
low complexity region 337 345 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172663
AA Change: Y142F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134547
Gene: ENSMUSG00000054128
AA Change: Y142F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173133
AA Change: Y144F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134469
Gene: ENSMUSG00000054128
AA Change: Y144F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 205 2.6e-84 PFAM
IGc1 224 295 1.6e-20 SMART
transmembrane domain 315 334 N/A INTRINSIC
low complexity region 337 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173629
SMART Domains Protein: ENSMUSP00000134607
Gene: ENSMUSG00000054128

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 25 119 1.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174101
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: This locus contains the sole gene encoding the thymic leukemia antigen or TL antigen in "b haplotype" mice such as C57BL/6. Mice homozygous for a targeted knock-out are viable with normal reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in H2-T3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:H2-T3 APN 17 36187041 missense probably benign
IGL01922:H2-T3 APN 17 36187100 missense possibly damaging 0.53
IGL02389:H2-T3 APN 17 36186608 missense probably benign 0.01
IGL02423:H2-T3 APN 17 36187356 missense probably damaging 0.98
IGL02963:H2-T3 APN 17 36189634 missense probably damaging 0.98
IGL03298:H2-T3 APN 17 36189428 missense probably damaging 1.00
hyperbole UTSW 17 36187345 missense probably damaging 1.00
simile UTSW 17 36187070 missense probably damaging 0.99
R1479:H2-T3 UTSW 17 36189428 missense probably damaging 1.00
R2907:H2-T3 UTSW 17 36187455 missense possibly damaging 0.90
R3623:H2-T3 UTSW 17 36190065 missense possibly damaging 0.91
R3624:H2-T3 UTSW 17 36190065 missense possibly damaging 0.91
R3779:H2-T3 UTSW 17 36189682 missense probably damaging 0.99
R4271:H2-T3 UTSW 17 36189618 missense probably damaging 1.00
R4586:H2-T3 UTSW 17 36189344 splice site probably null
R5351:H2-T3 UTSW 17 36190073 missense probably benign 0.06
R5387:H2-T3 UTSW 17 36186702 missense probably benign 0.00
R5474:H2-T3 UTSW 17 36190107 missense probably damaging 0.99
R5711:H2-T3 UTSW 17 36187409 missense probably damaging 1.00
R6458:H2-T3 UTSW 17 36187019 missense possibly damaging 0.53
R6849:H2-T3 UTSW 17 36189805 missense probably benign 0.32
R6993:H2-T3 UTSW 17 36187070 missense probably damaging 0.99
R7336:H2-T3 UTSW 17 36187345 missense probably damaging 1.00
R7414:H2-T3 UTSW 17 36187383 missense not run
R8143:H2-T3 UTSW 17 36187492 missense probably benign 0.35
R8901:H2-T3 UTSW 17 36187360 missense probably damaging 0.99
R9697:H2-T3 UTSW 17 36189852 missense probably damaging 0.98
RF009:H2-T3 UTSW 17 36189402 intron probably benign
Z1176:H2-T3 UTSW 17 36186580 missense possibly damaging 0.86
Z1176:H2-T3 UTSW 17 36186582 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGATGGAGTTGTCTGCAGCC -3'
(R):5'- TGCAAGCCACCTAATCATGGG -3'

Sequencing Primer
(F):5'- TTGTCTGCAGCCACGCAC -3'
(R):5'- CCACCTAATCATGGGGTGCAAAAG -3'
Posted On 2018-11-28