Incidental Mutation 'R6956:Vmn2r84'
ID 541468
Institutional Source Beutler Lab
Gene Symbol Vmn2r84
Ensembl Gene ENSMUSG00000070601
Gene Name vomeronasal 2, receptor 84
Synonyms EG625068
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 130385316-130394241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130389267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 458 (C458F)
Ref Sequence ENSEMBL: ENSMUSP00000092079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094502]
AlphaFold D3YWE3
Predicted Effect probably damaging
Transcript: ENSMUST00000094502
AA Change: C458F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: C458F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 77 448 1.3e-27 PFAM
Pfam:NCD3G 508 561 6.9e-21 PFAM
Pfam:7tm_3 594 830 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Other mutations in Vmn2r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Vmn2r84 APN 10 130391225 missense possibly damaging 0.65
IGL01590:Vmn2r84 APN 10 130386095 missense probably damaging 1.00
IGL01639:Vmn2r84 APN 10 130389272 nonsense probably null
IGL01843:Vmn2r84 APN 10 130386279 missense probably benign
IGL01911:Vmn2r84 APN 10 130386408 missense probably damaging 0.99
IGL01937:Vmn2r84 APN 10 130385886 missense probably damaging 1.00
IGL01977:Vmn2r84 APN 10 130394066 missense probably benign 0.11
IGL02177:Vmn2r84 APN 10 130392012 missense probably benign 0.00
IGL02291:Vmn2r84 APN 10 130390748 missense probably damaging 1.00
IGL02590:Vmn2r84 APN 10 130391487 splice site probably benign
IGL02727:Vmn2r84 APN 10 130394126 missense possibly damaging 0.95
IGL02900:Vmn2r84 APN 10 130387992 splice site probably benign
IGL03383:Vmn2r84 APN 10 130386687 missense probably damaging 1.00
PIT4378001:Vmn2r84 UTSW 10 130385915 missense probably damaging 1.00
R0076:Vmn2r84 UTSW 10 130394193 missense probably damaging 1.00
R0089:Vmn2r84 UTSW 10 130386719 splice site probably benign
R0153:Vmn2r84 UTSW 10 130392008 missense probably benign 0.06
R0611:Vmn2r84 UTSW 10 130386122 missense probably damaging 1.00
R0883:Vmn2r84 UTSW 10 130391115 missense probably damaging 0.99
R1237:Vmn2r84 UTSW 10 130387856 splice site probably null
R1295:Vmn2r84 UTSW 10 130389139 missense probably benign 0.12
R1401:Vmn2r84 UTSW 10 130391990 missense possibly damaging 0.89
R1521:Vmn2r84 UTSW 10 130389268 missense probably benign 0.10
R1590:Vmn2r84 UTSW 10 130391480 critical splice acceptor site probably null
R1710:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R1891:Vmn2r84 UTSW 10 130386069 missense possibly damaging 0.78
R1956:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1957:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1962:Vmn2r84 UTSW 10 130390722 missense probably damaging 0.99
R1994:Vmn2r84 UTSW 10 130386009 missense probably damaging 1.00
R2124:Vmn2r84 UTSW 10 130391231 missense probably damaging 0.99
R2409:Vmn2r84 UTSW 10 130392071 missense probably damaging 0.99
R2474:Vmn2r84 UTSW 10 130386523 missense possibly damaging 0.50
R2851:Vmn2r84 UTSW 10 130394167 missense probably benign 0.05
R3508:Vmn2r84 UTSW 10 130390908 missense probably damaging 1.00
R3792:Vmn2r84 UTSW 10 130385800 makesense probably null
R4051:Vmn2r84 UTSW 10 130390898 missense probably damaging 1.00
R4061:Vmn2r84 UTSW 10 130386029 missense probably damaging 1.00
R4091:Vmn2r84 UTSW 10 130391369 missense probably damaging 1.00
R4190:Vmn2r84 UTSW 10 130391294 nonsense probably null
R4520:Vmn2r84 UTSW 10 130386522 missense probably damaging 1.00
R4584:Vmn2r84 UTSW 10 130390713 missense probably benign 0.00
R4588:Vmn2r84 UTSW 10 130385940 missense probably damaging 0.98
R4655:Vmn2r84 UTSW 10 130394104 nonsense probably null
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R5022:Vmn2r84 UTSW 10 130386548 missense probably damaging 1.00
R5146:Vmn2r84 UTSW 10 130386102 missense probably damaging 1.00
R5237:Vmn2r84 UTSW 10 130385994 missense probably damaging 0.99
R5695:Vmn2r84 UTSW 10 130389195 missense probably benign 0.12
R5793:Vmn2r84 UTSW 10 130385885 missense probably damaging 0.99
R6210:Vmn2r84 UTSW 10 130386245 missense probably damaging 1.00
R6286:Vmn2r84 UTSW 10 130390868 missense possibly damaging 0.65
R6580:Vmn2r84 UTSW 10 130389241 missense possibly damaging 0.93
R6607:Vmn2r84 UTSW 10 130390862 missense possibly damaging 0.87
R6818:Vmn2r84 UTSW 10 130386278 missense probably benign 0.09
R6994:Vmn2r84 UTSW 10 130391007 missense possibly damaging 0.90
R7075:Vmn2r84 UTSW 10 130391072 missense probably damaging 0.99
R7225:Vmn2r84 UTSW 10 130386683 missense probably damaging 0.99
R7252:Vmn2r84 UTSW 10 130386410 missense probably damaging 1.00
R7263:Vmn2r84 UTSW 10 130389208 missense probably damaging 1.00
R7297:Vmn2r84 UTSW 10 130391250 missense probably benign 0.19
R7439:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7441:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7857:Vmn2r84 UTSW 10 130390869 missense probably benign 0.00
R8263:Vmn2r84 UTSW 10 130391168 missense probably damaging 1.00
R8555:Vmn2r84 UTSW 10 130394231 missense probably benign 0.28
R8766:Vmn2r84 UTSW 10 130386372 missense probably damaging 0.98
R8821:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R8831:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R8970:Vmn2r84 UTSW 10 130386375 missense probably damaging 0.98
R9164:Vmn2r84 UTSW 10 130385800 makesense probably null
R9190:Vmn2r84 UTSW 10 130390974 missense probably benign 0.03
R9261:Vmn2r84 UTSW 10 130394107 missense probably benign 0.00
R9310:Vmn2r84 UTSW 10 130392124 missense possibly damaging 0.81
R9434:Vmn2r84 UTSW 10 130385876 missense possibly damaging 0.65
R9613:Vmn2r84 UTSW 10 130390722 missense probably damaging 0.99
Z1177:Vmn2r84 UTSW 10 130391902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGAAAACCTTGAATCTGGAG -3'
(R):5'- TACACGCGGGATTATTTCAATACAG -3'

Sequencing Primer
(F):5'- AATCCAGAGGCCTTTGATGC -3'
(R):5'- CGGGATTATTTCAATACAGCTGTC -3'
Posted On 2018-11-28