Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Slc12a4'

541461

Institutional Source

Beutler Lab

Gene Symbol

Slc12a4

Ensembl Gene

ENSMUSG00000017765

Gene Name

solute carrier family 12, member 4

Synonyms

KCC1, K-Cl Co-transporter-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.256) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105943590-105966097 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105953852 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 211 (F211L)

Ref Sequence

ENSEMBL: ENSMUSP00000112130 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034370] [ENSMUST00000116429]

AlphaFold

Q9JIS8

Predicted Effect

probably damaging
Transcript: ENSMUST00000034370
AA Change: F213L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765
AA Change: F213L

Domain	Start	End	E-Value	Type
low complexity region	97	117	N/A	INTRINSIC
Pfam:AA_permease	125	318	5.8e-28	PFAM
Pfam:AA_permease	409	698	1.2e-40	PFAM
Pfam:SLC12	710	833	7.1e-18	PFAM
Pfam:SLC12	829	1087	4.8e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000116429
AA Change: F211L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765
AA Change: F211L

Domain	Start	End	E-Value	Type
low complexity region	95	115	N/A	INTRINSIC
Pfam:AA_permease	123	309	7.7e-29	PFAM
Pfam:AA_permease_2	390	654	2.9e-17	PFAM
Pfam:AA_permease	404	696	4.4e-39	PFAM
Pfam:KCl_Cotrans_1	953	982	9.2e-21	PFAM
low complexity region	1065	1080	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132231

SMART Domains

Protein: ENSMUSP00000121018
Gene: ENSMUSG00000017765

Domain	Start	End	E-Value	Type
low complexity region	66	86	N/A	INTRINSIC
Pfam:AA_permease	94	171	1.3e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183884

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a constitutively active mutation display microcytosis and hypochromic anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Aars	G	A	8: 111,055,130	V945M	probably benign	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,297,558	D604G	probably damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Nat10	T	C	2: 103,734,412	I495V	probably benign	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,707,600	N75D	probably damaging	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 91,286,313		probably null	Het
Scube1	T	C	15: 83,721,876	Y65C	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp1	A	G	4: 98,931,006	E235G	probably damaging	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Slc12a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01471:Slc12a4	APN	8	105944089	missense	probably damaging	1.00
IGL01637:Slc12a4	APN	8	105960707	missense	possibly damaging	0.72
IGL01736:Slc12a4	APN	8	105945843	critical splice donor site	probably null
IGL01804:Slc12a4	APN	8	105944401	missense	probably damaging	1.00
IGL02000:Slc12a4	APN	8	105945232	missense	probably damaging	1.00
IGL02526:Slc12a4	APN	8	105949806	missense	possibly damaging	0.90
IGL03371:Slc12a4	APN	8	105950505	missense	probably null	0.99
IGL03385:Slc12a4	APN	8	105950864	unclassified	probably benign
ablution	UTSW	8	105945223	missense	probably damaging	1.00
custom	UTSW	8	105950836	missense	probably benign	0.00
Custom2	UTSW	8	105945244	critical splice acceptor site	probably null
custom3	UTSW	8	105949739	missense	probably damaging	1.00
PIT4810001:Slc12a4	UTSW	8	105951596	missense	probably benign	0.00
R0033:Slc12a4	UTSW	8	105947479	splice site	probably benign
R0200:Slc12a4	UTSW	8	105951617	missense	probably benign	0.09
R0201:Slc12a4	UTSW	8	105945350	missense	possibly damaging	0.79
R0270:Slc12a4	UTSW	8	105945389	missense	probably benign	0.10
R0389:Slc12a4	UTSW	8	105951967	missense	probably benign	0.00
R0432:Slc12a4	UTSW	8	105959488	missense	probably damaging	1.00
R0751:Slc12a4	UTSW	8	105951900	missense	probably damaging	1.00
R1717:Slc12a4	UTSW	8	105947571	splice site	probably null
R1792:Slc12a4	UTSW	8	105951843	missense	possibly damaging	0.91
R1940:Slc12a4	UTSW	8	105946037	missense	probably benign	0.29
R3115:Slc12a4	UTSW	8	105959459	missense	probably damaging	1.00
R4898:Slc12a4	UTSW	8	105944609	missense	probably damaging	1.00
R5182:Slc12a4	UTSW	8	105944606	missense	probably damaging	1.00
R5220:Slc12a4	UTSW	8	105953852	missense	probably damaging	1.00
R5283:Slc12a4	UTSW	8	105950694	critical splice donor site	probably null
R5367:Slc12a4	UTSW	8	105951634	missense	probably damaging	0.99
R5610:Slc12a4	UTSW	8	105950213	missense	possibly damaging	0.87
R5921:Slc12a4	UTSW	8	105945244	critical splice acceptor site	probably null
R6060:Slc12a4	UTSW	8	105945706	missense	probably damaging	1.00
R6182:Slc12a4	UTSW	8	105947899	missense	probably damaging	1.00
R6722:Slc12a4	UTSW	8	105944250	splice site	probably null
R6800:Slc12a4	UTSW	8	105949739	missense	probably damaging	1.00
R7032:Slc12a4	UTSW	8	105949233	missense	probably damaging	1.00
R7092:Slc12a4	UTSW	8	105945223	missense	probably damaging	1.00
R7229:Slc12a4	UTSW	8	105946737	missense	probably benign	0.05
R7243:Slc12a4	UTSW	8	105953920	missense	probably damaging	1.00
R7323:Slc12a4	UTSW	8	105955715	missense	probably damaging	1.00
R7325:Slc12a4	UTSW	8	105955715	missense	probably damaging	1.00
R7327:Slc12a4	UTSW	8	105955715	missense	probably damaging	1.00
R7426:Slc12a4	UTSW	8	105950836	missense	probably benign	0.00
R7569:Slc12a4	UTSW	8	105945847	missense	probably damaging	1.00
R7710:Slc12a4	UTSW	8	105945571	missense	possibly damaging	0.95
R7968:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7970:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7971:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7972:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7973:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R8221:Slc12a4	UTSW	8	105951969	missense	probably benign	0.00
R8386:Slc12a4	UTSW	8	105951618	missense	probably damaging	1.00
R8393:Slc12a4	UTSW	8	105951819	missense	probably damaging	0.99
R8751:Slc12a4	UTSW	8	105949653	critical splice donor site	probably null
R8786:Slc12a4	UTSW	8	105953917	missense	probably damaging	1.00
R8792:Slc12a4	UTSW	8	105946758	missense	probably damaging	1.00
R8941:Slc12a4	UTSW	8	105946690	critical splice donor site	probably null
R8965:Slc12a4	UTSW	8	105945350	missense	possibly damaging	0.79
R9100:Slc12a4	UTSW	8	105949142	missense	probably benign	0.30
R9113:Slc12a4	UTSW	8	105944352	missense	probably benign	0.09
X0019:Slc12a4	UTSW	8	105944352	missense	probably damaging	0.98
Z1177:Slc12a4	UTSW	8	105946732	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GAGCAATGGGTTTTCTCTCTAAAGG -3'
(R):5'- AGTCAGGACAGATTCTGCGC -3'

Sequencing Primer
(F):5'- AATGGGTTTTCTCTCTAAAGGCCTCC -3'
(R):5'- ACAGATTCTGCGCTGGTC -3'

Posted On

2018-11-28