Incidental Mutation 'R7225:Por'
ID562088
Institutional Source Beutler Lab
Gene Symbol Por
Ensembl Gene ENSMUSG00000005514
Gene NameP450 (cytochrome) oxidoreductase
SynonymsNADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135670033-135735326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135732587 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 309 (D309G)
Ref Sequence ENSEMBL: ENSMUSP00000005651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005651] [ENSMUST00000043378] [ENSMUST00000122113] [ENSMUST00000127096] [ENSMUST00000153399] [ENSMUST00000153500] [ENSMUST00000153515]
Predicted Effect probably benign
Transcript: ENSMUST00000005651
AA Change: D309G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005651
Gene: ENSMUSG00000005514
AA Change: D309G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 1.6e-40 PFAM
Pfam:FAD_binding_1 274 493 1.3e-84 PFAM
Pfam:NAD_binding_1 530 642 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043378
SMART Domains Protein: ENSMUSP00000045252
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 13 336 4.2e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122113
AA Change: D309G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112924
Gene: ENSMUSG00000005514
AA Change: D309G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 2.6e-40 PFAM
Pfam:FAD_binding_1 274 493 5.1e-87 PFAM
Pfam:NAD_binding_1 530 605 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127096
SMART Domains Protein: ENSMUSP00000119138
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Flavodoxin_1 127 168 5.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153399
SMART Domains Protein: ENSMUSP00000120834
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 12 93 9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153500
SMART Domains Protein: ENSMUSP00000121531
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153515
SMART Domains Protein: ENSMUSP00000121022
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 3.2e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects of the neural tube, eye, heart, and limbs, retarded growth, and prenatal lethality. Liver-specific knockouts exhibit increased liver weight, hepatic lipidosis, and impaired drug metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Por
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Por APN 5 135734186 nonsense probably null
IGL02126:Por APN 5 135715975 missense probably benign 0.00
R0201:Por UTSW 5 135731178 missense possibly damaging 0.94
R0355:Por UTSW 5 135732584 missense probably benign 0.38
R1755:Por UTSW 5 135729485 nonsense probably null
R1886:Por UTSW 5 135734274 missense probably damaging 1.00
R4057:Por UTSW 5 135731574 missense probably damaging 1.00
R4282:Por UTSW 5 135715961 missense possibly damaging 0.48
R4761:Por UTSW 5 135725930 intron probably benign
R5057:Por UTSW 5 135730902 missense probably damaging 1.00
R5064:Por UTSW 5 135733795 missense probably benign 0.23
R5159:Por UTSW 5 135730917 missense probably benign 0.38
R5580:Por UTSW 5 135733821 missense probably damaging 0.98
R5895:Por UTSW 5 135715984 missense probably benign 0.03
R7422:Por UTSW 5 135734919 missense probably benign 0.06
R7461:Por UTSW 5 135729504 missense probably damaging 0.99
R7488:Por UTSW 5 135733644 missense probably benign 0.00
R7613:Por UTSW 5 135729504 missense probably damaging 0.99
R7649:Por UTSW 5 135734505 missense probably damaging 0.99
R7736:Por UTSW 5 135731122 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACAGCCCATGCAGTATTC -3'
(R):5'- GGATCTCCCCAATCTGGTTG -3'

Sequencing Primer
(F):5'- TTCATGTCCCTGGAAGGCTCAG -3'
(R):5'- TGACCAGGGTGGAGTCG -3'
Posted On2019-06-26