Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Ptpn18'

562071

Institutional Source

Beutler Lab

Gene Symbol

Ptpn18

Ensembl Gene

ENSMUSG00000026126

Gene Name

protein tyrosine phosphatase, non-receptor type 18

Synonyms

PTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R7225 (G1)

Quality Score

183.009

Status

Validated

Chromosome

Chromosomal Location

34459762-34475733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34472846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 366 (T366I)

Ref Sequence

ENSEMBL: ENSMUSP00000027302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]

AlphaFold

Q61152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027302
AA Change: T366I

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: T366I

Domain	Start	End	E-Value	Type
PTPc	25	293	7.77e-115	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188972
AA Change: T17I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000190122

SMART Domains

Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

Domain	Start	End	E-Value	Type
PTPc	2	269	9.1e-113	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Ptpn18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Ptpn18	APN	1	34463119	missense	probably damaging	0.98
IGL01611:Ptpn18	APN	1	34459817	utr 5 prime	probably benign
IGL01633:Ptpn18	APN	1	34471908	missense	probably benign	0.03
IGL03379:Ptpn18	APN	1	34470257	splice site	probably null
R0848:Ptpn18	UTSW	1	34462702	missense	probably damaging	1.00
R1400:Ptpn18	UTSW	1	34463506	critical splice donor site	probably null
R1973:Ptpn18	UTSW	1	34463109	missense	probably damaging	1.00
R2040:Ptpn18	UTSW	1	34470219	missense	probably damaging	0.99
R2113:Ptpn18	UTSW	1	34471661	missense	probably damaging	1.00
R2963:Ptpn18	UTSW	1	34471692	nonsense	probably null
R4061:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4062:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4509:Ptpn18	UTSW	1	34462742	missense	possibly damaging	0.49
R4522:Ptpn18	UTSW	1	34472960	missense	probably benign
R4626:Ptpn18	UTSW	1	34471792	splice site	probably null
R4978:Ptpn18	UTSW	1	34469813	intron	probably benign
R5260:Ptpn18	UTSW	1	34463510	splice site	probably benign
R5335:Ptpn18	UTSW	1	34463178	missense	probably damaging	1.00
R5481:Ptpn18	UTSW	1	34471663	missense	possibly damaging	0.67
R5865:Ptpn18	UTSW	1	34471563	splice site	probably benign
R7038:Ptpn18	UTSW	1	34459825	start codon destroyed	probably null	1.00
R7290:Ptpn18	UTSW	1	34462811	critical splice donor site	probably null
R7411:Ptpn18	UTSW	1	34472192	critical splice donor site	probably null
R7434:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7441:Ptpn18	UTSW	1	34473335	missense	probably benign	0.00
R7442:Ptpn18	UTSW	1	34462750	missense	probably benign	0.02
R7462:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7463:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7464:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7465:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7535:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7537:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7678:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7689:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7899:Ptpn18	UTSW	1	34469905	splice site	probably null
R8543:Ptpn18	UTSW	1	34472148	missense	probably benign	0.00
R8821:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8831:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8858:Ptpn18	UTSW	1	34463115	missense	possibly damaging	0.88
R8879:Ptpn18	UTSW	1	34463130	missense	probably benign	0.23
R8924:Ptpn18	UTSW	1	34459885	missense	probably benign	0.02
X0065:Ptpn18	UTSW	1	34469891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTTTCTGCCCTCAGGTGG -3'
(R):5'- AGGTACTTGTCCTCAGCTCC -3'

Sequencing Primer
(F):5'- TCCTGCTCTGAAGACTGGG -3'
(R):5'- GTACTTGTCCTCAGCTCCACACC -3'

Posted On

2019-06-26