Incidental Mutation 'R7240:Gnai2'
ID563149
Institutional Source Beutler Lab
Gene Symbol Gnai2
Ensembl Gene ENSMUSG00000032562
Gene Nameguanine nucleotide binding protein (G protein), alpha inhibiting 2
SynonymsGia, Galphai2, Gnai-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107614125-107635367 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 107615773 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 310 (D310E)
Ref Sequence ENSEMBL: ENSMUSP00000057543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055704] [ENSMUST00000192615] [ENSMUST00000192837] [ENSMUST00000193394]
Predicted Effect
SMART Domains Protein: ENSMUSP00000057543
Gene: ENSMUSG00000032562
AA Change: D310E

DomainStartEndE-ValueType
G_alpha 13 354 2.1e-219 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000142326
Gene: ENSMUSG00000032562
AA Change: D310E

DomainStartEndE-ValueType
G_alpha 13 354 2.1e-219 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192837
SMART Domains Protein: ENSMUSP00000141929
Gene: ENSMUSG00000032562

DomainStartEndE-ValueType
PDB:4N0E|A 1 40 4e-18 PDB
Blast:G_alpha 13 85 9e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193394
SMART Domains Protein: ENSMUSP00000141472
Gene: ENSMUSG00000032562

DomainStartEndE-ValueType
G_alpha 1 160 2.2e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Nullizygous mice exhibit growth retardation, lethal ulcerative colitis, colon adenocarcinomas, granulocytosis, altered thymocyte maturation and function and enhanced production of pro-inflammatory cytokines, and may show alterations in leukocyte physiology and susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Gnai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Gnai2 APN 9 107616518 missense probably damaging 1.00
IGL02408:Gnai2 APN 9 107616194 missense probably benign
R0520:Gnai2 UTSW 9 107620173 missense probably benign 0.01
R1106:Gnai2 UTSW 9 107620186 missense probably damaging 1.00
R5443:Gnai2 UTSW 9 107620187 missense probably damaging 0.96
R5479:Gnai2 UTSW 9 107635166 missense probably benign 0.14
R6312:Gnai2 UTSW 9 107635117 missense probably damaging 1.00
R6313:Gnai2 UTSW 9 107620097 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCAGACCCCTGTTGTTTGAC -3'
(R):5'- CCTCTACCGTTGAGCATACGTAC -3'

Sequencing Primer
(F):5'- TGTTTGACAACCCCCTGAC -3'
(R):5'- CTACCGTTGAGCATACGTACATAGG -3'
Posted On2019-06-26