Mutagenetix > Incidental Mutation

Incidental Mutation 'R7240:Ntn4'

563154

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

045347-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7240 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93745741 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 592 (H592R)

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204]

AlphaFold

Q9JI33

Predicted Effect

probably damaging
Transcript: ENSMUST00000020204
AA Change: H592R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: H592R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210017I01Rik	A	G	3: 92,605,075	I59T	unknown	Het
Aspm	C	T	1: 139,478,651	Q1759*	probably null	Het
Atn1	A	T	6: 124,747,898	I124K	unknown	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Ccdc88c	C	T	12: 100,944,939	V879M	probably benign	Het
Cd300c	A	G	11: 114,959,783	C65R	possibly damaging	Het
Cd69	A	T	6: 129,270,042	S112T	possibly damaging	Het
Cdh19	T	C	1: 110,893,407	T534A	probably benign	Het
Cdk5rap2	T	A	4: 70,291,908	D701V	probably damaging	Het
D130052B06Rik	A	G	11: 33,623,874	H157R	possibly damaging	Het
Dpf1	T	A	7: 29,311,627	F150L	probably benign	Het
Dsg1c	T	C	18: 20,283,109	L689P	probably damaging	Het
Dstyk	G	A	1: 132,454,123	M538I	probably benign	Het
E4f1	T	A	17: 24,444,325	I669F	probably damaging	Het
Gm7138	T	C	10: 77,776,755	T64A	unknown	Het
Gnai2	A	C	9: 107,615,773	D310E		Het
Iqca	A	G	1: 90,070,550	V567A	possibly damaging	Het
Iqgap1	A	T	7: 80,759,839	N249K	probably benign	Het
Lamc1	A	G	1: 153,234,650	V1093A	possibly damaging	Het
Mfap3	A	G	11: 57,529,756	K188E	probably damaging	Het
N4bp2	T	A	5: 65,794,545	V431D	probably damaging	Het
Notch4	A	G	17: 34,576,471	T792A	probably benign	Het
Ofcc1	A	G	13: 40,208,841	C202R	probably benign	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr418	T	C	1: 173,270,994	I273T	probably benign	Het
Olfr476	T	C	7: 107,968,188	S264P	probably benign	Het
Olfr497	A	G	7: 108,422,933	M121V	probably damaging	Het
Olfr922	A	G	9: 38,815,713	D70G	probably benign	Het
Olfr938	A	T	9: 39,078,610	M45K	probably damaging	Het
Parpbp	G	A	10: 88,124,940	T228I	probably damaging	Het
Pcdhgb8	G	A	18: 37,763,703	V609M	probably damaging	Het
Pla2g4d	T	C	2: 120,270,349	N543S	probably damaging	Het
Puf60	A	G	15: 76,072,539		probably benign	Het
Rbm6	A	T	9: 107,852,896	D184E	probably damaging	Het
Rnase9	A	C	14: 51,038,979	S181A	probably benign	Het
Rnpc3	T	A	3: 113,616,831	R270S	probably damaging	Het
Rundc1	T	C	11: 101,431,548		probably null	Het
Ryr1	T	C	7: 29,052,015	S3715G	possibly damaging	Het
Scn3a	A	T	2: 65,469,042	D1373E	possibly damaging	Het
Serpina3k	T	G	12: 104,340,602	I31S	probably benign	Het
Sipa1l2	A	G	8: 125,469,860	F712L	probably damaging	Het
Slc22a29	A	G	19: 8,161,511	V529A	probably damaging	Het
Tdrd3	A	G	14: 87,458,803	N58S	probably benign	Het
Tmc2	C	T	2: 130,234,804	T350I	possibly damaging	Het
Tpst2	T	C	5: 112,307,678	C28R	probably benign	Het
Trbv21	A	T	6: 41,202,958	K69N	probably benign	Het
Trpm2	A	G	10: 77,935,876		probably null	Het
Ttn	A	G	2: 76,848,990	V10796A	unknown	Het
Ush2a	A	G	1: 188,911,661	T4407A	possibly damaging	Het
Vmn2r95	A	G	17: 18,451,963	H726R	probably benign	Het
Zfp777	A	G	6: 48,044,449	S80P	probably benign	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
R9008:Ntn4	UTSW	10	93733604	splice site	probably benign
R9010:Ntn4	UTSW	10	93644644	missense
R9115:Ntn4	UTSW	10	93733813	missense	probably benign
R9415:Ntn4	UTSW	10	93644626	missense	probably benign	0.00
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTATGGAACTGCTAAAGCCGC -3'
(R):5'- ATTAGACTTGTGTATCTGCTACCC -3'

Sequencing Primer
(F):5'- AGCCGCAGTACCTCCTTTAATAG -3'
(R):5'- TACCCAGAGAAAAGCCCTTGTGTG -3'

Posted On

2019-06-26