Incidental Mutation 'R7240:Olfr497'
ID563145
Institutional Source Beutler Lab
Gene Symbol Olfr497
Ensembl Gene ENSMUSG00000095239
Gene Nameolfactory receptor 497
SynonymsGA_x6K02T2PBJ9-10752603-10753547, MOR204-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108420421-108424911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108422933 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 121 (M121V)
Ref Sequence ENSEMBL: ENSMUSP00000150439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076406] [ENSMUST00000213521]
Predicted Effect probably damaging
Transcript: ENSMUST00000076406
AA Change: M121V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075741
Gene: ENSMUSG00000095239
AA Change: M121V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 5.5e-55 PFAM
Pfam:7tm_1 44 293 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213521
AA Change: M121V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Olfr497
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr497 APN 7 108423028 nonsense probably null
IGL03145:Olfr497 APN 7 108422599 missense probably benign 0.00
R0732:Olfr497 UTSW 7 108422577 missense probably benign 0.00
R1892:Olfr497 UTSW 7 108422940 missense possibly damaging 0.61
R2008:Olfr497 UTSW 7 108423182 missense probably benign 0.01
R3721:Olfr497 UTSW 7 108423119 missense probably damaging 1.00
R4497:Olfr497 UTSW 7 108422915 missense probably benign 0.37
R4674:Olfr497 UTSW 7 108423102 missense possibly damaging 0.65
R4675:Olfr497 UTSW 7 108423102 missense possibly damaging 0.65
R4695:Olfr497 UTSW 7 108422989 missense probably benign 0.18
R5265:Olfr497 UTSW 7 108423402 missense possibly damaging 0.94
R5656:Olfr497 UTSW 7 108422618 missense probably benign 0.03
R5758:Olfr497 UTSW 7 108423162 missense probably benign 0.02
R6124:Olfr497 UTSW 7 108423518 splice site probably null
R6787:Olfr497 UTSW 7 108422682 missense possibly damaging 0.52
R7174:Olfr497 UTSW 7 108423160 missense probably benign 0.01
R7222:Olfr497 UTSW 7 108422637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATCAGAGTCTCGTCCCAG -3'
(R):5'- GAGAGTTCCACCAAAGGAGC -3'

Sequencing Primer
(F):5'- GAGTCTCGTCCCAGCTCCATC -3'
(R):5'- GAGAGTTCCACCAAAGGAGCAAAATC -3'
Posted On2019-06-26