Incidental Mutation 'R7240:Catsper2'
ID563129
Institutional Source Beutler Lab
Gene Symbol Catsper2
Ensembl Gene ENSMUSG00000033486
Gene Namecation channel, sperm associated 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7240 (G1)
Quality Score135.474
Status Not validated
Chromosome2
Chromosomal Location121392631-121413792 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT at 121397572 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038073] [ENSMUST00000154604]
Predicted Effect probably benign
Transcript: ENSMUST00000038073
SMART Domains Protein: ENSMUSP00000037222
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:Ion_trans 105 350 1e-35 PFAM
low complexity region 422 447 N/A INTRINSIC
internal_repeat_1 450 473 3.72e-11 PROSPERO
internal_repeat_1 465 488 3.72e-11 PROSPERO
low complexity region 491 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154604
SMART Domains Protein: ENSMUSP00000119091
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. This gene is part of a tandem repeat on chromosome 15q15; the second copy of this gene is thought to be a pseudogene. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null male mice are infertile due to a sperm motility defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Catsper2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Catsper2 APN 2 121397892 splice site probably benign
IGL01830:Catsper2 APN 2 121407362 missense probably damaging 1.00
IGL03243:Catsper2 APN 2 121406819 missense probably benign 0.08
IGL03247:Catsper2 APN 2 121410200 missense probably benign 0.03
IGL03342:Catsper2 APN 2 121406736 missense probably damaging 0.99
FR4304:Catsper2 UTSW 2 121397542 nonsense probably null
FR4304:Catsper2 UTSW 2 121397782 utr 3 prime probably benign
FR4342:Catsper2 UTSW 2 121397793 utr 3 prime probably benign
FR4589:Catsper2 UTSW 2 121397779 utr 3 prime probably benign
FR4737:Catsper2 UTSW 2 121397540 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397542 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397779 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397782 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397795 utr 3 prime probably benign
R1463:Catsper2 UTSW 2 121406446 missense probably damaging 1.00
R1686:Catsper2 UTSW 2 121400042 critical splice donor site probably null
R2006:Catsper2 UTSW 2 121406357 nonsense probably null
R2163:Catsper2 UTSW 2 121400175 missense probably damaging 1.00
R4543:Catsper2 UTSW 2 121407409 nonsense probably null
R4888:Catsper2 UTSW 2 121397123 splice site probably null
R5121:Catsper2 UTSW 2 121397123 splice site probably null
R5323:Catsper2 UTSW 2 121406735 missense probably damaging 1.00
R5518:Catsper2 UTSW 2 121406363 missense possibly damaging 0.69
R5605:Catsper2 UTSW 2 121397052 missense possibly damaging 0.91
R6521:Catsper2 UTSW 2 121406807 missense probably damaging 1.00
R6531:Catsper2 UTSW 2 121399780 missense possibly damaging 0.67
R7055:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7138:Catsper2 UTSW 2 121397063 missense possibly damaging 0.85
R7247:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7686:Catsper2 UTSW 2 121397456 splice site probably null
R8385:Catsper2 UTSW 2 121410140 missense possibly damaging 0.46
R8426:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R8463:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
RF028:Catsper2 UTSW 2 121397726 utr 3 prime probably benign
Z1176:Catsper2 UTSW 2 121407385 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTTTTAAAATCATCCTGGGCCAC -3'
(R):5'- AGCGATGCTACTGAAAGCGATG -3'

Sequencing Primer
(F):5'- CAAAACAATGACTGTGGGTCTC -3'
(R):5'- CTACTGAAAGCGATGGCGAG -3'
Posted On2019-06-26