Incidental Mutation 'R7320:Slmap'
ID568164
Institutional Source Beutler Lab
Gene Symbol Slmap
Ensembl Gene ENSMUSG00000021870
Gene Namesarcolemma associated protein
SynonymsD330001L02Rik, Slap
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7320 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26413168-26534931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26460072 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 369 (F369L)
Ref Sequence ENSEMBL: ENSMUSP00000117816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]
Predicted Effect probably benign
Transcript: ENSMUST00000038522
AA Change: F369L

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870
AA Change: F369L

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090359
AA Change: F369L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870
AA Change: F369L

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 490 572 N/A INTRINSIC
coiled coil region 599 799 N/A INTRINSIC
transmembrane domain 801 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102956
AA Change: F369L

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870
AA Change: F369L

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112330
AA Change: F369L

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870
AA Change: F369L

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 383 N/A INTRINSIC
coiled coil region 452 534 N/A INTRINSIC
coiled coil region 561 761 N/A INTRINSIC
transmembrane domain 763 785 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112331
AA Change: F248L

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870
AA Change: F248L

DomainStartEndE-ValueType
coiled coil region 46 78 N/A INTRINSIC
coiled coil region 109 260 N/A INTRINSIC
coiled coil region 352 434 N/A INTRINSIC
coiled coil region 461 661 N/A INTRINSIC
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139075
AA Change: F369L

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870
AA Change: F369L

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 507 589 N/A INTRINSIC
coiled coil region 616 816 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123072
Gene: ENSMUSG00000021870
AA Change: F34L

DomainStartEndE-ValueType
coiled coil region 1 52 N/A INTRINSIC
coiled coil region 97 179 N/A INTRINSIC
coiled coil region 206 405 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117276
Gene: ENSMUSG00000021870
AA Change: F38L

DomainStartEndE-ValueType
coiled coil region 1 59 N/A INTRINSIC
coiled coil region 138 220 N/A INTRINSIC
coiled coil region 247 447 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123344
Gene: ENSMUSG00000021870
AA Change: F132L

DomainStartEndE-ValueType
coiled coil region 17 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Slmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Slmap APN 14 26463710 missense probably damaging 0.97
IGL02612:Slmap APN 14 26459466 splice site probably benign
IGL02630:Slmap APN 14 26422431 missense possibly damaging 0.93
IGL02798:Slmap APN 14 26470378 missense possibly damaging 0.88
PIT4382001:Slmap UTSW 14 26533431 missense probably damaging 1.00
R0433:Slmap UTSW 14 26453594 nonsense probably null
R0963:Slmap UTSW 14 26468520 missense probably damaging 1.00
R1721:Slmap UTSW 14 26460218 splice site probably benign
R1848:Slmap UTSW 14 26422574 missense probably benign
R2151:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2152:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2153:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2154:Slmap UTSW 14 26418247 missense probably damaging 1.00
R3725:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3726:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3935:Slmap UTSW 14 26459415 missense probably benign
R4118:Slmap UTSW 14 26482872 missense probably damaging 0.99
R4594:Slmap UTSW 14 26465617 missense probably damaging 1.00
R4731:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4732:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4733:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4817:Slmap UTSW 14 26462352 missense probably damaging 0.97
R4847:Slmap UTSW 14 26426608 missense possibly damaging 0.90
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R5092:Slmap UTSW 14 26463589 missense probably damaging 1.00
R5211:Slmap UTSW 14 26482962 missense probably damaging 1.00
R5387:Slmap UTSW 14 26459933 missense probably benign 0.22
R5821:Slmap UTSW 14 26462280 missense probably damaging 1.00
R6404:Slmap UTSW 14 26422411 splice site probably null
R6856:Slmap UTSW 14 26430092 intron probably null
R6977:Slmap UTSW 14 26533419 missense probably damaging 1.00
R7108:Slmap UTSW 14 26422521 missense probably benign 0.04
R7470:Slmap UTSW 14 26427420 missense probably benign
R7520:Slmap UTSW 14 26427420 missense probably benign
R7540:Slmap UTSW 14 26460191 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429846 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429848 missense probably damaging 0.99
Z1177:Slmap UTSW 14 26533450 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGACACCTACCTAAGCTGC -3'
(R):5'- AAATGAATGGGGTCAGTTCTGG -3'

Sequencing Primer
(F):5'- ACCTAAGCTGCTGCATTCTTTAAGG -3'
(R):5'- CTGGCTTTCAGCTAGCTAAAGCAAG -3'
Posted On2019-06-26