Incidental Mutation 'R7504:Cdkn1a'
ID 581692
Institutional Source Beutler Lab
Gene Symbol Cdkn1a
Ensembl Gene ENSMUSG00000023067
Gene Name cyclin-dependent kinase inhibitor 1A (P21)
Synonyms SDI1, P21, Waf1, p21Cip1, CIP1, CAP20, mda6, p21, Cdkn1, p21WAF, CDKI
MMRRC Submission 045577-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 29090979-29100722 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29098514 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 36 (L36P)
Ref Sequence ENSEMBL: ENSMUSP00000023829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023829] [ENSMUST00000119901] [ENSMUST00000122348]
AlphaFold P39689
Predicted Effect probably damaging
Transcript: ENSMUST00000023829
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023829
Gene: ENSMUSG00000023067
AA Change: L36P

DomainStartEndE-ValueType
Pfam:CDI 19 67 8.1e-23 PFAM
PDB:2ZVW|P 134 154 8e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000119901
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113150
Gene: ENSMUSG00000023067
AA Change: L36P

DomainStartEndE-ValueType
Pfam:CDI 18 68 6.9e-24 PFAM
PDB:2ZVW|P 134 154 8e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000122348
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112411
Gene: ENSMUSG00000023067
AA Change: L36P

DomainStartEndE-ValueType
Pfam:CDI 18 68 6.9e-24 PFAM
PDB:2ZVW|P 134 154 8e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at the G1 pahse. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for knock-out alleles exhibit increased spontaneous tumorigenesis, altered resistance to induced tumors, abnormal immune system morphology and physiology, delayed cellular senescence, abnormal response to xenobiotics and injury, and autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Cdkn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Cdkn1a APN 17 29098520 missense possibly damaging 0.83
IGL00495:Cdkn1a APN 17 29098520 missense possibly damaging 0.83
IGL00516:Cdkn1a APN 17 29098520 missense possibly damaging 0.83
IGL02409:Cdkn1a APN 17 29098454 missense probably benign
R1812:Cdkn1a UTSW 17 29098565 missense probably benign
R6076:Cdkn1a UTSW 17 29099358 missense probably damaging 1.00
R8035:Cdkn1a UTSW 17 29099376 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CACCTTAGTCTCATGGTGTGG -3'
(R):5'- AAGTACTGGGCCTCTTGTCC -3'

Sequencing Primer
(F):5'- TGGTGGAAAAGCACCTGC -3'
(R):5'- TGTCCCCTCCCAGGTCG -3'
Posted On 2019-10-17