Incidental Mutation 'R7504:Sv2b'
ID 581669
Institutional Source Beutler Lab
Gene Symbol Sv2b
Ensembl Gene ENSMUSG00000053025
Gene Name synaptic vesicle glycoprotein 2 b
Synonyms A830038F04Rik
MMRRC Submission 045577-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 75114894-75309262 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75136383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 430 (F430I)
Ref Sequence ENSEMBL: ENSMUSP00000082254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085164] [ENSMUST00000165175] [ENSMUST00000206344]
AlphaFold Q8BG39
Predicted Effect probably benign
Transcript: ENSMUST00000085164
AA Change: F430I

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082254
Gene: ENSMUSG00000053025
AA Change: F430I

DomainStartEndE-ValueType
Pfam:Sugar_tr 93 415 3.8e-29 PFAM
Pfam:MFS_1 111 429 9.3e-25 PFAM
Pfam:MFS_1 517 681 8.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165175
AA Change: F430I

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127245
Gene: ENSMUSG00000053025
AA Change: F430I

DomainStartEndE-ValueType
Pfam:Sugar_tr 89 412 1.5e-29 PFAM
Pfam:MFS_1 111 429 9.5e-25 PFAM
Pfam:Pentapeptide_4 453 528 7.9e-11 PFAM
Pfam:MFS_1 516 681 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206344
AA Change: F430I

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000207001
Meta Mutation Damage Score 0.0682 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation are phenotypically normal, and Sv2a/Sv2b double knockouts are no more affected than Sv2a single knockouts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 (GRCm38) A14G probably damaging Het
Btn1a1 A T 13: 23,461,716 (GRCm38) M161K probably benign Het
Camkk2 G A 5: 122,746,308 (GRCm38) T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 (GRCm38) D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 (GRCm38) L36P probably damaging Het
Dek A G 13: 47,088,035 (GRCm38) I351T probably damaging Het
Dst T C 1: 34,201,017 (GRCm38) Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 (GRCm38) N300K probably damaging Het
Ephx2 A G 14: 66,101,617 (GRCm38) Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 (GRCm38) I198N probably damaging Het
Grid1 G T 14: 35,562,513 (GRCm38) A738S probably damaging Het
Gsx2 G A 5: 75,076,399 (GRCm38) probably null Het
Hc G A 2: 35,061,319 (GRCm38) T22I not run Het
Hps1 T C 19: 42,766,720 (GRCm38) D261G probably benign Het
Ift80 T C 3: 68,918,005 (GRCm38) Y539C probably damaging Het
Insc G T 7: 114,791,298 (GRCm38) probably null Het
Isg15 T C 4: 156,200,045 (GRCm38) M9V probably damaging Het
Kalrn A G 16: 34,256,233 (GRCm38) L695P unknown Het
Nars1 A C 18: 64,512,022 (GRCm38) F52V probably benign Het
Nmt1 T G 11: 103,056,459 (GRCm38) F225V probably damaging Het
Or10q12 T A 19: 13,768,732 (GRCm38) I130N probably damaging Het
Or7a36 A G 10: 78,984,660 (GRCm38) Y290C possibly damaging Het
Or8c8 A T 9: 38,254,243 (GRCm38) K272N possibly damaging Het
Pbx3 T C 2: 34,175,924 (GRCm38) T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 (GRCm38) T61S probably benign Het
Pramel40 G T 5: 94,317,047 (GRCm38) V431L probably benign Het
Rab11fip1 T C 8: 27,152,953 (GRCm38) E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 (GRCm38) Y589H probably benign Het
Scara3 A G 14: 65,931,331 (GRCm38) I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 (GRCm38) Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 (GRCm38) K415E probably benign Het
Stag1 C T 9: 100,888,328 (GRCm38) T639I probably benign Het
Tenm2 C T 11: 36,139,743 (GRCm38) C743Y probably damaging Het
Tet2 C A 3: 133,487,339 (GRCm38) V445L probably benign Het
Tmem132c T C 5: 127,554,632 (GRCm38) S652P probably damaging Het
Togaram1 A G 12: 64,992,617 (GRCm38) D1155G possibly damaging Het
Traip T C 9: 107,961,544 (GRCm38) I169T probably benign Het
Trmt9b A C 8: 36,512,155 (GRCm38) N304T probably benign Het
Usp45 T G 4: 21,816,892 (GRCm38) M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 (GRCm38) H263L probably benign Het
Wdr95 T C 5: 149,581,846 (GRCm38) V364A probably damaging Het
Zfp128 G A 7: 12,890,478 (GRCm38) D258N probably damaging Het
Zfp335 G A 2: 164,909,418 (GRCm38) T76I probably benign Het
Zfp688 C A 7: 127,419,311 (GRCm38) C214F probably damaging Het
Zfp760 T C 17: 21,722,674 (GRCm38) S277P probably damaging Het
Other mutations in Sv2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01463:Sv2b APN 7 75,136,455 (GRCm38) missense probably damaging 1.00
IGL02302:Sv2b APN 7 75,124,199 (GRCm38) missense probably damaging 0.98
IGL02352:Sv2b APN 7 75,136,449 (GRCm38) missense probably benign 0.01
IGL02359:Sv2b APN 7 75,136,449 (GRCm38) missense probably benign 0.01
IGL02698:Sv2b APN 7 75,140,978 (GRCm38) critical splice donor site probably null
IGL02713:Sv2b APN 7 75,124,163 (GRCm38) missense possibly damaging 0.66
IGL03075:Sv2b APN 7 75,136,320 (GRCm38) missense probably benign
IGL03392:Sv2b APN 7 75,156,760 (GRCm38) critical splice acceptor site probably null
R0015:Sv2b UTSW 7 75,125,641 (GRCm38) missense probably damaging 1.00
R0033:Sv2b UTSW 7 75,117,741 (GRCm38) missense probably benign 0.00
R0033:Sv2b UTSW 7 75,117,741 (GRCm38) missense probably benign 0.00
R0219:Sv2b UTSW 7 75,157,267 (GRCm38) critical splice donor site probably null
R0277:Sv2b UTSW 7 75,206,439 (GRCm38) missense possibly damaging 0.62
R0469:Sv2b UTSW 7 75,136,392 (GRCm38) missense probably benign
R0510:Sv2b UTSW 7 75,136,392 (GRCm38) missense probably benign
R1219:Sv2b UTSW 7 75,136,412 (GRCm38) missense probably benign 0.01
R1307:Sv2b UTSW 7 75,206,434 (GRCm38) missense probably damaging 1.00
R1476:Sv2b UTSW 7 75,120,043 (GRCm38) missense possibly damaging 0.72
R1520:Sv2b UTSW 7 75,157,329 (GRCm38) missense probably damaging 0.98
R1575:Sv2b UTSW 7 75,147,677 (GRCm38) missense probably damaging 0.97
R1585:Sv2b UTSW 7 75,147,677 (GRCm38) missense probably damaging 0.97
R1666:Sv2b UTSW 7 75,206,341 (GRCm38) missense probably benign 0.01
R1712:Sv2b UTSW 7 75,149,059 (GRCm38) missense possibly damaging 0.78
R1864:Sv2b UTSW 7 75,124,080 (GRCm38) missense probably benign 0.17
R1993:Sv2b UTSW 7 75,206,341 (GRCm38) missense probably benign 0.01
R2191:Sv2b UTSW 7 75,124,088 (GRCm38) missense probably damaging 1.00
R3836:Sv2b UTSW 7 75,157,428 (GRCm38) missense probably damaging 1.00
R4744:Sv2b UTSW 7 75,206,518 (GRCm38) missense probably benign 0.01
R4757:Sv2b UTSW 7 75,124,170 (GRCm38) missense probably benign 0.31
R4924:Sv2b UTSW 7 75,136,421 (GRCm38) missense probably benign 0.20
R4990:Sv2b UTSW 7 75,117,722 (GRCm38) missense possibly damaging 0.55
R4991:Sv2b UTSW 7 75,117,722 (GRCm38) missense possibly damaging 0.55
R5038:Sv2b UTSW 7 75,157,425 (GRCm38) missense probably damaging 1.00
R5726:Sv2b UTSW 7 75,124,214 (GRCm38) missense possibly damaging 0.67
R5885:Sv2b UTSW 7 75,156,753 (GRCm38) missense probably damaging 1.00
R6379:Sv2b UTSW 7 75,136,300 (GRCm38) missense possibly damaging 0.73
R6410:Sv2b UTSW 7 75,140,109 (GRCm38) missense probably benign 0.40
R6623:Sv2b UTSW 7 75,206,384 (GRCm38) missense probably damaging 1.00
R6709:Sv2b UTSW 7 75,124,139 (GRCm38) missense probably benign 0.40
R6873:Sv2b UTSW 7 75,206,206 (GRCm38) missense probably damaging 1.00
R6889:Sv2b UTSW 7 75,125,767 (GRCm38) splice site probably null
R7123:Sv2b UTSW 7 75,117,702 (GRCm38) missense possibly damaging 0.94
R7278:Sv2b UTSW 7 75,147,654 (GRCm38) missense probably damaging 0.99
R7363:Sv2b UTSW 7 75,147,654 (GRCm38) missense probably damaging 0.99
R7378:Sv2b UTSW 7 75,147,728 (GRCm38) critical splice acceptor site probably null
R7426:Sv2b UTSW 7 75,124,064 (GRCm38) missense probably damaging 1.00
R7452:Sv2b UTSW 7 75,147,713 (GRCm38) missense probably damaging 1.00
R8425:Sv2b UTSW 7 75,117,599 (GRCm38) missense probably damaging 1.00
R8490:Sv2b UTSW 7 75,206,085 (GRCm38) splice site probably null
R8752:Sv2b UTSW 7 75,206,094 (GRCm38) missense possibly damaging 0.85
R8905:Sv2b UTSW 7 75,117,711 (GRCm38) missense probably benign 0.00
R9058:Sv2b UTSW 7 75,140,074 (GRCm38) critical splice donor site probably null
R9075:Sv2b UTSW 7 75,140,097 (GRCm38) missense possibly damaging 0.93
R9114:Sv2b UTSW 7 75,206,269 (GRCm38) missense probably damaging 1.00
R9417:Sv2b UTSW 7 75,120,024 (GRCm38) missense probably damaging 0.99
R9568:Sv2b UTSW 7 75,125,680 (GRCm38) missense probably benign 0.12
R9596:Sv2b UTSW 7 75,117,714 (GRCm38) missense probably damaging 1.00
R9704:Sv2b UTSW 7 75,147,672 (GRCm38) missense possibly damaging 0.48
R9711:Sv2b UTSW 7 75,206,490 (GRCm38) missense probably benign 0.01
R9717:Sv2b UTSW 7 75,119,928 (GRCm38) missense probably benign 0.19
R9731:Sv2b UTSW 7 75,136,320 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTAGCAGTAAGGATGGGTTG -3'
(R):5'- TGGTCTACAGTAAGTCATGGATGC -3'

Sequencing Primer
(F):5'- GGAGTCCATCCTTAGTACACCGAG -3'
(R):5'- AGTCATGGATGCAGATTCCACTG -3'
Posted On 2019-10-17