Incidental Mutation 'R7508:Ube3a'
ID581894
Institutional Source Beutler Lab
Gene Symbol Ube3a
Ensembl Gene ENSMUSG00000025326
Gene Nameubiquitin protein ligase E3A
SynonymsHpve6a, 5830462N02Rik, E6-AP ubiquitin protein ligase, A130086L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location59228750-59311536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59303689 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 790 (H790Q)
Ref Sequence ENSEMBL: ENSMUSP00000143859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107537] [ENSMUST00000200758]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107537
AA Change: H769Q

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103161
Gene: ENSMUSG00000025326
AA Change: H769Q

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200758
AA Change: H790Q

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143859
Gene: ENSMUSG00000025326
AA Change: H790Q

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Ube3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ube3a APN 7 59272110 missense probably damaging 1.00
IGL00886:Ube3a APN 7 59284737 missense probably damaging 1.00
IGL02037:Ube3a APN 7 59275758 unclassified probably benign
IGL02127:Ube3a APN 7 59276041 missense probably benign 0.03
IGL02228:Ube3a APN 7 59288396 splice site probably benign
IGL02533:Ube3a APN 7 59304832 missense probably damaging 1.00
IGL02706:Ube3a APN 7 59272133 missense possibly damaging 0.67
IGL03037:Ube3a APN 7 59247223 splice site probably benign
IGL03213:Ube3a APN 7 59286122 nonsense probably null
IGL03306:Ube3a APN 7 59286147 missense probably damaging 1.00
Kebab UTSW 7 59288488 missense probably damaging 1.00
Shawarma UTSW 7 59276183 nonsense probably null
PIT4362001:Ube3a UTSW 7 59276122 missense possibly damaging 0.86
R0847:Ube3a UTSW 7 59276586 missense possibly damaging 0.80
R1765:Ube3a UTSW 7 59286114 missense probably damaging 1.00
R1771:Ube3a UTSW 7 59275966 missense probably damaging 1.00
R1926:Ube3a UTSW 7 59276379 missense probably damaging 1.00
R1992:Ube3a UTSW 7 59303787 missense probably damaging 1.00
R2026:Ube3a UTSW 7 59303726 missense probably damaging 1.00
R2104:Ube3a UTSW 7 59276477 missense possibly damaging 0.95
R3176:Ube3a UTSW 7 59276519 nonsense probably null
R3276:Ube3a UTSW 7 59276519 nonsense probably null
R3623:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3624:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3690:Ube3a UTSW 7 59276799 missense probably damaging 1.00
R4423:Ube3a UTSW 7 59276113 missense probably benign 0.10
R4583:Ube3a UTSW 7 59286063 missense probably damaging 1.00
R4883:Ube3a UTSW 7 59243450 start codon destroyed probably benign 0.21
R4992:Ube3a UTSW 7 59284820 missense possibly damaging 0.47
R5175:Ube3a UTSW 7 59288717 missense probably damaging 1.00
R5397:Ube3a UTSW 7 59286912 missense probably benign 0.26
R5545:Ube3a UTSW 7 59272024 missense probably damaging 1.00
R5572:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R5635:Ube3a UTSW 7 59288488 missense probably damaging 1.00
R5766:Ube3a UTSW 7 59276059 missense possibly damaging 0.89
R5890:Ube3a UTSW 7 59272028 missense probably damaging 1.00
R5956:Ube3a UTSW 7 59277020 unclassified probably benign
R6388:Ube3a UTSW 7 59304921 splice site probably null
R6464:Ube3a UTSW 7 59276183 nonsense probably null
R6467:Ube3a UTSW 7 59276902 missense probably damaging 1.00
R6474:Ube3a UTSW 7 59287024 missense probably damaging 1.00
R6669:Ube3a UTSW 7 59276857 missense probably benign 0.02
R7003:Ube3a UTSW 7 59276440 missense probably damaging 1.00
R7044:Ube3a UTSW 7 59288413 missense probably damaging 1.00
R7187:Ube3a UTSW 7 59275905 missense probably benign 0.02
R7360:Ube3a UTSW 7 59276635 missense probably damaging 1.00
R7363:Ube3a UTSW 7 59287003 missense probably benign 0.00
R7652:Ube3a UTSW 7 59243354 start gained probably benign
R7768:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R8015:Ube3a UTSW 7 59284756 missense probably damaging 1.00
R8044:Ube3a UTSW 7 59276572 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CATCACGCTTAGCATTAGGAATAC -3'
(R):5'- ACATGTTGGCTCTGCTTGC -3'

Sequencing Primer
(F):5'- CACGCTTAGCATTAGGAATACAAAAG -3'
(R):5'- TTGCGTGTATGGAATATGGTGAAAAG -3'
Posted On2019-10-17