Incidental Mutation 'R7508:Pgc'
ID581925
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Nameprogastricsin (pepsinogen C)
SynonymsUpg1, 2210410L06Rik, Upg-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47726842-47734482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47734186 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 343 (E343G)
Ref Sequence ENSEMBL: ENSMUSP00000024782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000126258] [ENSMUST00000144955]
Predicted Effect probably benign
Transcript: ENSMUST00000024782
AA Change: E343G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987
AA Change: E343G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113284
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113288
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000144955
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 47730666 missense probably benign 0.09
IGL01410:Pgc APN 17 47734240 missense probably damaging 0.98
IGL01647:Pgc APN 17 47732404 missense probably damaging 1.00
IGL02141:Pgc APN 17 47726931 missense probably damaging 1.00
IGL02719:Pgc APN 17 47728867 missense probably damaging 0.98
PIT4469001:Pgc UTSW 17 47728755 nonsense probably null
R0736:Pgc UTSW 17 47728780 missense probably damaging 1.00
R1118:Pgc UTSW 17 47728903 critical splice donor site probably null
R1669:Pgc UTSW 17 47733790 missense probably damaging 1.00
R2162:Pgc UTSW 17 47729311 missense probably null 0.96
R3831:Pgc UTSW 17 47729311 missense probably null 0.96
R3833:Pgc UTSW 17 47729311 missense probably null 0.96
R4454:Pgc UTSW 17 47732410 missense probably benign 0.00
R4908:Pgc UTSW 17 47728894 missense probably damaging 0.96
R5544:Pgc UTSW 17 47732504 missense probably benign 0.00
R6829:Pgc UTSW 17 47732781 splice site probably null
R7042:Pgc UTSW 17 47733820 missense probably benign 0.00
R8022:Pgc UTSW 17 47728776 missense probably benign 0.00
Z1176:Pgc UTSW 17 47728868 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAAGTTCTCACTCCTCTGGGC -3'
(R):5'- GGCTGGTCAATATGGAGGAC -3'

Sequencing Primer
(F):5'- TGTCTTCAAAGCTCGACTACCAG -3'
(R):5'- AGACCTGAGGAAGACATC -3'
Posted On2019-10-17