Incidental Mutation 'R7508:Rbm25'
ID581908
Institutional Source Beutler Lab
Gene Symbol Rbm25
Ensembl Gene ENSMUSG00000010608
Gene NameRNA binding motif protein 25
SynonymsA130095G20Rik, 2610015J01Rik, 2600011C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83631236-83683123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83672877 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 557 (L557P)
Ref Sequence ENSEMBL: ENSMUSP00000138572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048155] [ENSMUST00000181983] [ENSMUST00000182450]
Predicted Effect probably damaging
Transcript: ENSMUST00000048155
AA Change: L557P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048470
Gene: ENSMUSG00000010608
AA Change: L557P

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
low complexity region 234 241 N/A INTRINSIC
coiled coil region 270 351 N/A INTRINSIC
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 606 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
PWI 758 831 2.79e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181983
AA Change: L557P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138572
Gene: ENSMUSG00000010608
AA Change: L557P

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
internal_repeat_1 187 203 3e-5 PROSPERO
low complexity region 234 241 N/A INTRINSIC
internal_repeat_1 258 274 3e-5 PROSPERO
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
low complexity region 575 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182450
SMART Domains Protein: ENSMUSP00000138416
Gene: ENSMUSG00000010608

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
Meta Mutation Damage Score 0.2291 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Rbm25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Rbm25 APN 12 83659567 missense probably damaging 1.00
IGL02095:Rbm25 APN 12 83671974 missense probably damaging 1.00
IGL02227:Rbm25 APN 12 83672753 missense probably damaging 1.00
IGL02454:Rbm25 APN 12 83660322 missense probably benign 0.02
IGL02704:Rbm25 APN 12 83642726 missense probably damaging 1.00
IGL02726:Rbm25 APN 12 83672852 missense probably damaging 1.00
IGL03384:Rbm25 APN 12 83659523 missense probably benign 0.28
R0380:Rbm25 UTSW 12 83660356 missense probably benign 0.02
R0829:Rbm25 UTSW 12 83660376 splice site probably benign
R1330:Rbm25 UTSW 12 83677892 missense probably damaging 1.00
R1346:Rbm25 UTSW 12 83644393 splice site probably benign
R1518:Rbm25 UTSW 12 83668445 missense possibly damaging 0.91
R1566:Rbm25 UTSW 12 83675054 missense probably damaging 0.98
R1660:Rbm25 UTSW 12 83668150 unclassified probably benign
R1809:Rbm25 UTSW 12 83672727 splice site probably benign
R2213:Rbm25 UTSW 12 83676082 missense probably benign 0.00
R2336:Rbm25 UTSW 12 83651418 missense probably damaging 1.00
R2943:Rbm25 UTSW 12 83660641 missense probably damaging 1.00
R3971:Rbm25 UTSW 12 83675208 missense probably benign 0.03
R4349:Rbm25 UTSW 12 83675173 missense probably damaging 0.99
R4740:Rbm25 UTSW 12 83644407 missense possibly damaging 0.61
R4987:Rbm25 UTSW 12 83677856 missense probably damaging 1.00
R5205:Rbm25 UTSW 12 83672869 missense probably benign 0.03
R5579:Rbm25 UTSW 12 83668507 missense probably benign 0.41
R5603:Rbm25 UTSW 12 83664216 nonsense probably null
R5909:Rbm25 UTSW 12 83681588 missense probably damaging 0.97
R5930:Rbm25 UTSW 12 83677866 missense possibly damaging 0.46
R5982:Rbm25 UTSW 12 83671951 missense probably damaging 0.99
R6233:Rbm25 UTSW 12 83659426 missense probably benign 0.24
R6275:Rbm25 UTSW 12 83644432 missense probably damaging 0.98
R6282:Rbm25 UTSW 12 83676089 missense probably damaging 0.98
R7156:Rbm25 UTSW 12 83664191 missense unknown
R7188:Rbm25 UTSW 12 83663998 missense unknown
R7217:Rbm25 UTSW 12 83664217 missense unknown
R7403:Rbm25 UTSW 12 83676134 missense probably damaging 1.00
R7703:Rbm25 UTSW 12 83675090 missense possibly damaging 0.69
R8004:Rbm25 UTSW 12 83674392 missense possibly damaging 0.61
R8154:Rbm25 UTSW 12 83644431 missense unknown
R8444:Rbm25 UTSW 12 83664251 missense unknown
Z1176:Rbm25 UTSW 12 83672884 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTGGATGTTTACCTGAGTCTTAG -3'
(R):5'- TGCACCACCACTAAAGTGTTC -3'

Sequencing Primer
(F):5'- GATGTTTACCTGAGTCTTAGCATTC -3'
(R):5'- AGTTCTGAGTTCATTTAAGACTGATG -3'
Posted On2019-10-17