Incidental Mutation 'R7558:Gdi1'
ID584918
Institutional Source Beutler Lab
Gene Symbol Gdi1
Ensembl Gene ENSMUSG00000015291
Gene Nameguanosine diphosphate (GDP) dissociation inhibitor 1
SynonymsRab GDIalpha, GDIA
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R7558 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location74304998-74311862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74306855 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 55 (R55H)
Ref Sequence ENSEMBL: ENSMUSP00000015435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015435] [ENSMUST00000019231] [ENSMUST00000114171] [ENSMUST00000124797] [ENSMUST00000130581] [ENSMUST00000147275] [ENSMUST00000147900] [ENSMUST00000153141]
Predicted Effect probably benign
Transcript: ENSMUST00000015435
AA Change: R55H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015435
Gene: ENSMUSG00000015291
AA Change: R55H

DomainStartEndE-ValueType
Pfam:GDI 1 436 5.6e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019231
SMART Domains Protein: ENSMUSP00000019231
Gene: ENSMUSG00000019087

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 161 175 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114171
SMART Domains Protein: ENSMUSP00000109808
Gene: ENSMUSG00000019087

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ATP-synt_S1 38 405 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124797
SMART Domains Protein: ENSMUSP00000118722
Gene: ENSMUSG00000019087

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:ATP-synt_S1 20 100 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130581
SMART Domains Protein: ENSMUSP00000122146
Gene: ENSMUSG00000015291

DomainStartEndE-ValueType
Pfam:GDI 1 63 1.4e-29 PFAM
Pfam:GDI 61 140 6.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136056
SMART Domains Protein: ENSMUSP00000117604
Gene: ENSMUSG00000019087

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147275
SMART Domains Protein: ENSMUSP00000116162
Gene: ENSMUSG00000019087

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ATP-synt_S1 38 157 3.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147900
SMART Domains Protein: ENSMUSP00000117006
Gene: ENSMUSG00000019087

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ATP-synt_S1 38 224 1.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153141
AA Change: R33H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119805
Gene: ENSMUSG00000015291
AA Change: R33H

DomainStartEndE-ValueType
Pfam:GDI 1 78 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI1 is expressed primarily in neural and sensory tissues. Mutations in GDI1 have been linked to X-linked nonspecific mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males hemizygous for a reporter allele show lower male aggression, short-term memory defects, altered synaptic vesicle pools and short-term synaptic plasticity, and impaired glutamate release. Homozygotes for a null allele show enhanced paired-pulse facilitation and sensitivity to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Gdi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Gdi1 APN X 74307725 missense probably benign
R3545:Gdi1 UTSW X 74307808 missense possibly damaging 0.59
R3547:Gdi1 UTSW X 74307808 missense possibly damaging 0.59
R7097:Gdi1 UTSW X 74306855 missense probably benign 0.00
R7098:Gdi1 UTSW X 74306855 missense probably benign 0.00
R7099:Gdi1 UTSW X 74306855 missense probably benign 0.00
R7163:Gdi1 UTSW X 74306855 missense probably benign 0.00
R7212:Gdi1 UTSW X 74306855 missense probably benign 0.00
R7340:Gdi1 UTSW X 74306855 missense probably benign 0.00
R7341:Gdi1 UTSW X 74306855 missense probably benign 0.00
R7557:Gdi1 UTSW X 74306855 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCTGGAGGAGGTAAGATTTC -3'
(R):5'- TGACCTGTGTCCAGAGGAAATAAG -3'

Sequencing Primer
(F):5'- CTTATTCTTAGACCTGGGCTTAGAC -3'
(R):5'- GACTGACCATATTCTTGAGATTGACC -3'
Posted On2019-10-17