Incidental Mutation 'R7558:Foxk2'
ID584898
Institutional Source Beutler Lab
Gene Symbol Foxk2
Ensembl Gene ENSMUSG00000039275
Gene Nameforkhead box K2
Synonyms5730434B08Rik, Ilf1, 1110054H05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location121259990-121309896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121288058 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 239 (S239P)
Ref Sequence ENSEMBL: ENSMUSP00000101719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106113]
Predicted Effect probably benign
Transcript: ENSMUST00000106113
AA Change: S239P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101719
Gene: ENSMUSG00000039275
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
FHA 47 119 9.96e-10 SMART
FH 247 338 2.2e-52 SMART
low complexity region 440 465 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a fork head DNA binding domain. This protein can bind to the purine-rich motifs of the HIV long terminal repeat (LTR), and to the similar purine-rich motif in the interleukin 2 (IL2) promoter. It may be involved in the regulation of viral and cellular promoter elements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Foxk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Foxk2 APN 11 121299734 missense probably damaging 1.00
IGL00502:Foxk2 APN 11 121297099 splice site probably benign
IGL02619:Foxk2 APN 11 121299576 splice site probably benign
IGL03067:Foxk2 APN 11 121285568 missense possibly damaging 0.87
R1843:Foxk2 UTSW 11 121285537 missense probably benign 0.01
R2153:Foxk2 UTSW 11 121260387 missense probably benign 0.08
R2847:Foxk2 UTSW 11 121260491 small insertion probably benign
R3770:Foxk2 UTSW 11 121260491 small insertion probably benign
R4024:Foxk2 UTSW 11 121285613 missense possibly damaging 0.67
R6958:Foxk2 UTSW 11 121299737 missense probably benign 0.16
R6968:Foxk2 UTSW 11 121260482 missense possibly damaging 0.87
R7736:Foxk2 UTSW 11 121299647 missense possibly damaging 0.92
R7902:Foxk2 UTSW 11 121299727 missense probably benign
R7985:Foxk2 UTSW 11 121299727 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGAACAATACCATGCTTCC -3'
(R):5'- TCCACAAGGATGCACAAGTCAG -3'

Sequencing Primer
(F):5'- CAATACCATGCTTCCTTTAAAGGGC -3'
(R):5'- TGAGCAGCCTCTGGACATATCTG -3'
Posted On2019-10-17