Incidental Mutation 'R7558:Ptk2b'
ID584902
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene NamePTK2 protein tyrosine kinase 2 beta
SynonymsCAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R7558 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location66153257-66281052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66154179 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 969 (S969G)
Ref Sequence ENSEMBL: ENSMUSP00000137008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730] [ENSMUST00000206455]
Predicted Effect probably benign
Transcript: ENSMUST00000022620
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000022622
AA Change: S969G

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: S969G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089250
AA Change: S927G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456
AA Change: S927G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111121
AA Change: S965G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: S965G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456
AA Change: S341G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178730
AA Change: S969G

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: S969G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206455
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66177118 missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66158613 missense probably benign 0.00
IGL02121:Ptk2b APN 14 66213482 missense probably benign 0.12
IGL02505:Ptk2b APN 14 66154243 missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66173895 splice site probably benign
IGL03343:Ptk2b APN 14 66169421 missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66156381 missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66213372 missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66172144 missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66177751 missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66158598 missense probably benign 0.02
R1502:Ptk2b UTSW 14 66163080 missense possibly damaging 0.95
R1583:Ptk2b UTSW 14 66163114 missense possibly damaging 0.75
R1876:Ptk2b UTSW 14 66158392 missense probably benign 0.01
R1905:Ptk2b UTSW 14 66158670 missense probably damaging 1.00
R1942:Ptk2b UTSW 14 66169381 missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66172505 missense probably benign 0.28
R2377:Ptk2b UTSW 14 66172548 missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66178183 splice site probably null
R3793:Ptk2b UTSW 14 66170251 missense probably damaging 1.00
R3836:Ptk2b UTSW 14 66156342 missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66157068 missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66163047 missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66173300 splice site probably null
R4691:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4692:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4693:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4847:Ptk2b UTSW 14 66173882 missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66156415 missense probably damaging 1.00
R5297:Ptk2b UTSW 14 66172517 missense probably benign 0.04
R5603:Ptk2b UTSW 14 66172065 nonsense probably null
R5935:Ptk2b UTSW 14 66173879 missense probably damaging 1.00
R6245:Ptk2b UTSW 14 66163066 missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66178831 missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66187474 missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66213398 missense probably damaging 1.00
R7235:Ptk2b UTSW 14 66157087 nonsense probably null
R7511:Ptk2b UTSW 14 66154244 missense possibly damaging 0.81
X0054:Ptk2b UTSW 14 66213328 missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66154094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGCTTTCCCTGGAAGAC -3'
(R):5'- TCCCCAGGGAACTTCTGATG -3'

Sequencing Primer
(F):5'- GCTTTCCCTGGAAGACCAATAAC -3'
(R):5'- GGAACTTCTGATGTCTTAGCCAATGC -3'
Posted On2019-10-17