Mutagenetix > Incidental Mutation

Incidental Mutation 'R1122:Itgav'

95711

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

039195-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83791939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 622 (T622A)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably benign
Transcript: ENSMUST00000028499
AA Change: T658A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: T658A

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111740
AA Change: T622A

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: T622A

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	G	A	11: 70,011,377	L469F	probably damaging	Het
Adgrb1	C	A	15: 74,547,685	R792S	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap15	A	T	2: 44,142,295	H297L	probably benign	Het
BC003965	T	C	17: 25,184,872	I62T	probably benign	Het
Chtf18	T	C	17: 25,724,623	E333G	probably damaging	Het
Cyb5a	A	G	18: 84,877,839	T77A	possibly damaging	Het
Exosc10	T	C	4: 148,566,364	W456R	possibly damaging	Het
Fam160b1	A	T	19: 57,382,301	T551S	probably benign	Het
Fam189a2	T	C	19: 23,975,392	E518G	probably damaging	Het
Gad2	A	T	2: 22,623,451	Q31L	possibly damaging	Het
Gm9637	T	A	14: 19,401,879		noncoding transcript	Het
Kifc5b	T	A	17: 26,924,061	V269E	probably benign	Het
Lrrc15	T	C	16: 30,273,901	N207D	probably damaging	Het
Map2k5	A	G	9: 63,263,163	V291A	probably damaging	Het
Mrc1	G	A	2: 14,261,336		probably null	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Olfr101	T	A	17: 37,300,128	Q98L	probably damaging	Het
Olfr97	T	A	17: 37,232,043	D109V	probably damaging	Het
Pdzd2	A	G	15: 12,457,895	V294A	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnf220	C	T	4: 117,278,080	G171S	probably benign	Het
Slc6a4	T	C	11: 77,027,186	S585P	possibly damaging	Het
Slc7a8	T	C	14: 54,724,107	E528G	probably benign	Het
Slco4c1	A	G	1: 96,828,836	I587T	possibly damaging	Het
Syt4	T	A	18: 31,440,202	H420L	probably damaging	Het
Tec	T	C	5: 72,779,449	K236E	probably damaging	Het
Ttn	A	G	2: 76,715,332	V32549A	probably damaging	Het
Wdfy3	T	C	5: 101,882,966	H2299R	possibly damaging	Het
Zfp729b	A	G	13: 67,595,284	V64A	possibly damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ACCAGCGTTCAGTCGCACAATG -3'
(R):5'- GCTTCACTAAATACGGCCTGCCTC -3'

Sequencing Primer
(F):5'- TCAGTCGCACAATGTGGGG -3'
(R):5'- CTTACTTCGTTGTTCCGGACA -3'

Posted On

2014-01-05