Mutagenetix > Incidental Mutation

Incidental Mutation 'R4620:Itgav'

345213

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

042008-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83755902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 169 (Y169H)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably benign
Transcript: ENSMUST00000028499
AA Change: Y169H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: Y169H

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111740
AA Change: Y169H

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: Y169H

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125360

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152569

Meta Mutation Damage Score

0.1342

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	T	7: 131,343,606	Y433*	probably null	Het
Apba2	C	T	7: 64,714,467	R331C	probably damaging	Het
Apod	T	C	16: 31,297,393	D173G	probably benign	Het
B3gnt5	A	T	16: 19,769,882	M284L	probably benign	Het
Birc6	A	C	17: 74,640,150	T2955P	probably benign	Het
Blvra	T	C	2: 127,096,965	I287T	probably damaging	Het
Capn5	T	C	7: 98,129,371	Y347C	probably damaging	Het
Cdcp2	A	G	4: 107,106,730	E259G	probably damaging	Het
Cdh2	A	G	18: 16,648,608	V85A	probably benign	Het
Cdk5rap2	A	G	4: 70,266,706	I1169T	probably benign	Het
Cenpj	A	G	14: 56,535,454	V1043A	probably damaging	Het
Cfap54	T	A	10: 92,969,757	H1497L	probably benign	Het
Chat	A	G	14: 32,453,818	M95T	probably damaging	Het
Csmd1	T	C	8: 16,002,694		probably null	Het
Csmd3	T	C	15: 47,585,753	E3615G	probably benign	Het
Cyp2c68	A	T	19: 39,712,562		probably null	Het
Dll1	C	T	17: 15,370,566	A332T	probably benign	Het
Dmrta1	A	T	4: 89,688,784	Q159L	probably benign	Het
Eci3	A	T	13: 34,948,758	M212K	probably damaging	Het
Eml4	T	C	17: 83,461,533	F557L	probably benign	Het
Fat3	A	T	9: 15,996,894	V2604D	probably damaging	Het
Frem3	T	C	8: 80,668,957	V1871A	possibly damaging	Het
Gart	T	C	16: 91,625,433	N732S	probably damaging	Het
Gas2l2	T	C	11: 83,423,098	I463V	probably benign	Het
H2-M3	C	A	17: 37,272,419	T257K	probably damaging	Het
Hdgf	A	G	3: 87,914,576	N166S	possibly damaging	Het
Hoxb3	A	T	11: 96,345,773	N226Y	probably damaging	Het
Kalrn	T	G	16: 34,028,705	I426L	probably damaging	Het
Kcnh3	G	A	15: 99,234,101	V646M	probably damaging	Het
Kif6	T	C	17: 49,901,296	V735A	probably benign	Het
Krt2	T	A	15: 101,817,591	I171F	probably damaging	Het
Megf8	G	A	7: 25,355,098	A1880T	possibly damaging	Het
Miox	A	T	15: 89,336,121	Y172F	probably benign	Het
Myo18a	G	A	11: 77,817,947	R48H	possibly damaging	Het
Ndufb7	T	C	8: 83,566,858	S14P	probably damaging	Het
Npepps	A	T	11: 97,238,244	H371Q	probably damaging	Het
Olfr596	C	T	7: 103,309,958	T79I	probably benign	Het
Olfr672	T	A	7: 104,996,623	I94F	probably damaging	Het
Olfr876	A	G	9: 37,804,819	T303A	probably benign	Het
Olfr976	C	T	9: 39,956,909	V9M	probably damaging	Het
Orc5	A	T	5: 22,529,176	D203E	probably damaging	Het
Pappa	A	G	4: 65,327,028	T1518A	probably benign	Het
Pde6a	A	G	18: 61,262,492	D602G	probably damaging	Het
Pnliprp2	G	A	19: 58,762,286	V136I	possibly damaging	Het
Postn	A	C	3: 54,376,993	D627A	probably damaging	Het
Prpf39	T	C	12: 65,042,563	V25A	probably benign	Het
Pxdc1	A	G	13: 34,652,314	I41T	probably damaging	Het
Rab11fip1	T	A	8: 27,154,215	E514V	probably damaging	Het
Rag1	A	T	2: 101,643,680	H372Q	probably damaging	Het
Ranbp1	A	G	16: 18,240,104		probably benign	Het
Rexo5	A	G	7: 119,827,303	I317V	probably benign	Het
Rragc	A	G	4: 123,924,829	Q279R	probably damaging	Het
Sbf1	A	G	15: 89,306,926	S187P	probably damaging	Het
Senp3	T	A	11: 69,677,118	Y432F	probably benign	Het
Slfn5	G	A	11: 82,961,652	C868Y	probably damaging	Het
Sorcs2	C	T	5: 36,037,494	A722T	probably benign	Het
Sptb	A	T	12: 76,583,807	C2244*	probably null	Het
Srbd1	A	T	17: 86,109,265	F488L	probably benign	Het
Sucnr1	A	G	3: 60,086,769	I239M	possibly damaging	Het
Themis2	A	G	4: 132,786,022	W298R	probably damaging	Het
Tmem168	T	G	6: 13,594,953	N37T	probably benign	Het
Tmem62	A	G	2: 120,996,364		probably benign	Het
Tmprss15	T	C	16: 79,021,470	D524G	probably damaging	Het
Trav5-4	G	T	14: 53,704,396	M75I	probably benign	Het
Trio	T	A	15: 27,871,171	H620L	probably damaging	Het
Ubap2	C	T	4: 41,233,698	G64E	probably damaging	Het
Usp32	C	A	11: 85,059,127		probably null	Het
Wdfy3	A	T	5: 101,906,145	F1603Y	probably damaging	Het
Wdr63	A	T	3: 146,042,809	L850Q	probably damaging	Het
Xpo4	A	T	14: 57,630,325	L155Q	probably damaging	Het
Zbtb21	T	C	16: 97,949,892	T1092A	possibly damaging	Het
Zfp780b	A	T	7: 27,962,753	Y792*	probably null	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTCCTGTGATAAAGCAGAGGC -3'
(R):5'- AGGATGACCAAACTGAGTTCTTAG -3'

Sequencing Primer
(F):5'- AAGTTTTCAATGTTTAGTGCTCTTG -3'
(R):5'- CCAAACTGAGTTCTTAGAAACATGG -3'

Posted On

2015-09-25