Incidental Mutation 'R4765:Azi2'
ID366069
Institutional Source Beutler Lab
Gene Symbol Azi2
Ensembl Gene ENSMUSG00000039285
Gene Name5-azacytidine induced gene 2
SynonymsAZ2
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location118040499-118069794 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 118061471 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044220] [ENSMUST00000044454] [ENSMUST00000133580] [ENSMUST00000134433] [ENSMUST00000135251] [ENSMUST00000154583] [ENSMUST00000215799]
Predicted Effect probably benign
Transcript: ENSMUST00000044220
SMART Domains Protein: ENSMUSP00000047904
Gene: ENSMUSG00000039163

DomainStartEndE-ValueType
Pfam:Cmc1 19 87 5.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044454
SMART Domains Protein: ENSMUSP00000044350
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 278 4.2e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123690
AA Change: H47L
SMART Domains Protein: ENSMUSP00000121245
Gene: ENSMUSG00000039285
AA Change: H47L

DomainStartEndE-ValueType
Pfam:TBD 1 51 4.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130735
SMART Domains Protein: ENSMUSP00000114634
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 22 123 N/A INTRINSIC
Pfam:TBD 153 197 3.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133580
SMART Domains Protein: ENSMUSP00000118765
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 226 278 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133814
Predicted Effect probably benign
Transcript: ENSMUST00000134433
SMART Domains Protein: ENSMUSP00000114980
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 273 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135251
SMART Domains Protein: ENSMUSP00000116971
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 20 50 N/A INTRINSIC
Pfam:TBD 77 131 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154583
SMART Domains Protein: ENSMUSP00000122063
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215799
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired GM-CSF-derived bone marrow-derived dendritic cell differenatiation, cytokine response and ability to stimulate T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Azi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Azi2 APN 9 118059146 missense probably damaging 0.97
awry UTSW 9 118047419 start codon destroyed probably null 0.99
R0166:Azi2 UTSW 9 118055841 missense possibly damaging 0.82
R0636:Azi2 UTSW 9 118062057 missense probably benign 0.03
R2024:Azi2 UTSW 9 118049322 nonsense probably null
R3498:Azi2 UTSW 9 118049407 missense probably damaging 0.99
R3713:Azi2 UTSW 9 118047440 missense possibly damaging 0.65
R3899:Azi2 UTSW 9 118047503 missense probably damaging 1.00
R5227:Azi2 UTSW 9 118047458 missense probably damaging 1.00
R5839:Azi2 UTSW 9 118059119 missense probably damaging 1.00
R5885:Azi2 UTSW 9 118047560 missense probably damaging 1.00
R6021:Azi2 UTSW 9 118047419 start codon destroyed probably null 0.99
R6276:Azi2 UTSW 9 118049338 missense probably damaging 0.96
R6408:Azi2 UTSW 9 118061482 nonsense probably null
R6525:Azi2 UTSW 9 118047595 missense probably damaging 0.96
R6889:Azi2 UTSW 9 118049895 critical splice acceptor site probably null
R7391:Azi2 UTSW 9 118050892 splice site probably null
R7693:Azi2 UTSW 9 118047593 missense probably damaging 1.00
R7889:Azi2 UTSW 9 118061915 missense probably benign 0.20
R8042:Azi2 UTSW 9 118062097 missense probably benign 0.01
R8142:Azi2 UTSW 9 118049407 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAACCCTCTCCCACTGAG -3'
(R):5'- GTCAGTCTTCTAGAAGTTGAGATTG -3'

Sequencing Primer
(F):5'- TGAGAAATTTCAGTAAGCCAAAGAAC -3'
(R):5'- TTATATACCAGCTTTACAACTGACAC -3'
Posted On2015-12-21