Incidental Mutation 'R7714:Ttll4'
ID 594760
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
MMRRC Submission 045772-MU
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Essential gene? Possibly non essential (E-score: 0.368) question?
Stock # R7714 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74661745-74703730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74679413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 141 (S141L)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: S141L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: S141L

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113678
AA Change: S141L

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: S141L

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,805,172 (GRCm38) E32G possibly damaging Het
2010300C02Rik T A 1: 37,624,777 (GRCm38) Q680L probably benign Het
Adam22 A G 5: 8,117,587 (GRCm38) probably null Het
Agrn C A 4: 156,195,397 (GRCm38) D106Y probably damaging Het
Arfgap3 A T 15: 83,308,151 (GRCm38) Y416N probably benign Het
Atp6v0a2 C T 5: 124,637,595 (GRCm38) T135M probably damaging Het
Bach1 C A 16: 87,718,848 (GRCm38) Y92* probably null Het
Catsperg1 A C 7: 29,185,482 (GRCm38) C905G probably null Het
Cbr2 T C 11: 120,729,802 (GRCm38) I219V probably benign Het
Ccdc3 A T 2: 5,229,097 (GRCm38) K244I probably damaging Het
Cd226 T C 18: 89,247,309 (GRCm38) V237A probably damaging Het
Chek2 T C 5: 110,841,453 (GRCm38) C81R probably benign Het
Col27a1 T C 4: 63,324,486 (GRCm38) probably null Het
Crybg3 A T 16: 59,558,873 (GRCm38) S673T probably benign Het
Csmd2 T A 4: 128,382,950 (GRCm38) Y848* probably null Het
Dgkb C A 12: 38,630,593 (GRCm38) T764K probably damaging Het
Dock4 T A 12: 40,725,649 (GRCm38) C530* probably null Het
Dpyd A G 3: 118,804,131 (GRCm38) K254R probably benign Het
Dstyk C T 1: 132,456,876 (GRCm38) P703S possibly damaging Het
Ehhadh A T 16: 21,766,390 (GRCm38) I247N probably damaging Het
Fer1l5 T G 1: 36,401,477 (GRCm38) L597R probably damaging Het
Fignl1 T C 11: 11,802,842 (GRCm38) E71G probably damaging Het
Fnip2 A C 3: 79,518,114 (GRCm38) V58G probably damaging Het
Gapdhs A T 7: 30,731,924 (GRCm38) I377N probably damaging Het
Gcn1l1 C T 5: 115,595,300 (GRCm38) A1059V probably damaging Het
Gm884 T C 11: 103,616,893 (GRCm38) I1416M unknown Het
Gpd1 G A 15: 99,722,086 (GRCm38) S255N probably damaging Het
Grik2 A C 10: 49,419,696 (GRCm38) I392S probably damaging Het
Hoxb3 T C 11: 96,345,780 (GRCm38) L228P probably damaging Het
Iws1 A T 18: 32,090,515 (GRCm38) M659L probably benign Het
Kmt2c A G 5: 25,375,366 (GRCm38) C570R probably benign Het
Lamc3 T A 2: 31,922,267 (GRCm38) probably null Het
Lipf G A 19: 33,965,648 (GRCm38) G119R probably damaging Het
Magel2 A T 7: 62,378,382 (GRCm38) I345L probably benign Het
Mdn1 G A 4: 32,722,360 (GRCm38) A2381T possibly damaging Het
Med12l T C 3: 59,093,586 (GRCm38) V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 (GRCm38) probably benign Het
Mob3b A G 4: 35,083,872 (GRCm38) Y106H probably damaging Het
Myo1c T C 11: 75,658,693 (GRCm38) Y166H probably damaging Het
Ndst4 A T 3: 125,570,844 (GRCm38) H390L probably benign Het
Nt5c1b T A 12: 10,375,472 (GRCm38) N280K probably damaging Het
Olfr1471 A T 19: 13,445,888 (GRCm38) N292I probably damaging Het
Olfr433 G A 1: 174,042,334 (GRCm38) R128H probably benign Het
Otof A G 5: 30,370,253 (GRCm38) F1947L probably damaging Het
Pabpc4 G A 4: 123,295,309 (GRCm38) A481T probably benign Het
Parm1 C T 5: 91,593,932 (GRCm38) T53I possibly damaging Het
Pilra C T 5: 137,835,417 (GRCm38) R129Q probably benign Het
Pkd1 C T 17: 24,550,276 (GRCm38) A5V unknown Het
Pmch T C 10: 88,091,380 (GRCm38) S82P probably benign Het
Prf1 G A 10: 61,300,155 (GRCm38) R70H possibly damaging Het
Rad51c T C 11: 87,401,450 (GRCm38) S180G probably benign Het
Rassf8 A C 6: 145,815,247 (GRCm38) T100P probably damaging Het
Rnpepl1 A G 1: 92,917,168 (GRCm38) E394G probably damaging Het
Rufy2 T A 10: 63,002,993 (GRCm38) V418E probably benign Het
Sdad1 A T 5: 92,302,679 (GRCm38) V199D probably damaging Het
Sptbn4 A T 7: 27,364,336 (GRCm38) S2227T probably benign Het
Tac4 A G 11: 95,265,290 (GRCm38) M66V probably benign Het
Tas2r126 T C 6: 42,435,097 (GRCm38) V188A probably benign Het
Tcerg1 T C 18: 42,560,935 (GRCm38) V707A possibly damaging Het
Trav13-4-dv7 G A 14: 53,757,898 (GRCm38) G103D probably damaging Het
Trav8d-1 A G 14: 52,778,923 (GRCm38) S89G probably benign Het
Vash1 T C 12: 86,691,840 (GRCm38) S354P probably benign Het
Vmn2r40 T A 7: 8,908,117 (GRCm38) I726F Het
Vmn2r53 A C 7: 12,606,491 (GRCm38) N18K probably damaging Het
Wnt6 T C 1: 74,784,263 (GRCm38) F253S probably damaging Het
Zfp599 A G 9: 22,250,515 (GRCm38) I118T probably benign Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74,685,893 (GRCm38) missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74,688,193 (GRCm38) missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74,679,058 (GRCm38) missense probably benign 0.01
IGL02288:Ttll4 APN 1 74,679,401 (GRCm38) missense probably benign 0.05
IGL02621:Ttll4 APN 1 74,687,484 (GRCm38) missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74,687,231 (GRCm38) splice site probably null
IGL02890:Ttll4 APN 1 74,687,339 (GRCm38) nonsense probably null
IGL02937:Ttll4 APN 1 74,679,503 (GRCm38) missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74,680,408 (GRCm38) missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74,687,321 (GRCm38) missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74,689,980 (GRCm38) missense probably null 1.00
R0083:Ttll4 UTSW 1 74,679,769 (GRCm38) missense probably benign 0.13
R0108:Ttll4 UTSW 1 74,679,769 (GRCm38) missense probably benign 0.13
R0135:Ttll4 UTSW 1 74,679,928 (GRCm38) missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74,679,692 (GRCm38) missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74,696,757 (GRCm38) missense probably benign 0.28
R0506:Ttll4 UTSW 1 74,688,618 (GRCm38) missense probably benign 0.06
R0555:Ttll4 UTSW 1 74,688,280 (GRCm38) missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74,679,401 (GRCm38) missense probably benign 0.05
R1649:Ttll4 UTSW 1 74,697,470 (GRCm38) missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74,687,840 (GRCm38) missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74,697,482 (GRCm38) missense probably benign 0.01
R1952:Ttll4 UTSW 1 74,687,559 (GRCm38) missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74,685,368 (GRCm38) missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74,685,368 (GRCm38) missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74,680,382 (GRCm38) missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74,686,391 (GRCm38) missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74,679,829 (GRCm38) missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74,686,438 (GRCm38) splice site probably null
R2876:Ttll4 UTSW 1 74,686,438 (GRCm38) splice site probably null
R2895:Ttll4 UTSW 1 74,685,358 (GRCm38) missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74,685,358 (GRCm38) missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74,697,611 (GRCm38) missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74,686,391 (GRCm38) missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74,679,007 (GRCm38) missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74,679,007 (GRCm38) missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74,679,007 (GRCm38) missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74,679,286 (GRCm38) missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74,687,852 (GRCm38) critical splice donor site probably null
R5244:Ttll4 UTSW 1 74,696,448 (GRCm38) missense probably benign 0.30
R5264:Ttll4 UTSW 1 74,686,376 (GRCm38) missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74,679,321 (GRCm38) missense probably benign 0.06
R5992:Ttll4 UTSW 1 74,685,391 (GRCm38) missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74,697,539 (GRCm38) missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74,681,789 (GRCm38) missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74,681,353 (GRCm38) missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74,679,349 (GRCm38) missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74,689,413 (GRCm38) missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74,681,816 (GRCm38) missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74,688,661 (GRCm38) missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74,687,259 (GRCm38) missense possibly damaging 0.81
R7837:Ttll4 UTSW 1 74,681,757 (GRCm38) critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74,696,473 (GRCm38) missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74,679,230 (GRCm38) missense probably benign 0.02
R8115:Ttll4 UTSW 1 74,687,330 (GRCm38) nonsense probably null
R8949:Ttll4 UTSW 1 74,681,816 (GRCm38) missense probably damaging 0.99
R9145:Ttll4 UTSW 1 74,679,790 (GRCm38) missense probably benign 0.02
R9156:Ttll4 UTSW 1 74,680,066 (GRCm38) missense probably benign 0.00
R9329:Ttll4 UTSW 1 74,685,962 (GRCm38) missense possibly damaging 0.85
R9701:Ttll4 UTSW 1 74,681,323 (GRCm38) missense probably benign 0.07
R9802:Ttll4 UTSW 1 74,681,323 (GRCm38) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCACCAGTTTCTTGGGAGTC -3'
(R):5'- TTCCCTGAGATAGCAGAGGC -3'

Sequencing Primer
(F):5'- GAGTCCCATCCCAGCCAG -3'
(R):5'- ATAGCAGAGGCCAGGCTCTTC -3'
Posted On 2019-11-12