Mutagenetix > Incidental Mutations

Incidental Mutation 'R7714:Ttll4'

594760

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R7714 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 74679413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 141 (S141L)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

probably benign
Transcript: ENSMUST00000042125
AA Change: S141L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: S141L

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113678
AA Change: S141L

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: S141L

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (63/65)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	A	G	14: 32,805,172	E32G	possibly damaging	Het
2010300C02Rik	T	A	1: 37,624,777	Q680L	probably benign	Het
Adam22	A	G	5: 8,117,587		probably null	Het
Agrn	C	A	4: 156,195,397	D106Y	probably damaging	Het
Arfgap3	A	T	15: 83,308,151	Y416N	probably benign	Het
Atp6v0a2	C	T	5: 124,637,595	T135M	probably damaging	Het
Bach1	C	A	16: 87,718,848	Y92*	probably null	Het
Catsperg1	A	C	7: 29,185,482	C905G	probably null	Het
Cbr2	T	C	11: 120,729,802	I219V	probably benign	Het
Ccdc3	A	T	2: 5,229,097	K244I	probably damaging	Het
Cd226	T	C	18: 89,247,309	V237A	probably damaging	Het
Chek2	T	C	5: 110,841,453	C81R	probably benign	Het
Col27a1	T	C	4: 63,324,486		probably null	Het
Crybg3	A	T	16: 59,558,873	S673T	probably benign	Het
Csmd2	T	A	4: 128,382,950	Y848*	probably null	Het
Dgkb	C	A	12: 38,630,593	T764K	probably damaging	Het
Dock4	T	A	12: 40,725,649	C530*	probably null	Het
Dpyd	A	G	3: 118,804,131	K254R	probably benign	Het
Dstyk	C	T	1: 132,456,876	P703S	possibly damaging	Het
Ehhadh	A	T	16: 21,766,390	I247N	probably damaging	Het
Fer1l5	T	G	1: 36,401,477	L597R	probably damaging	Het
Fignl1	T	C	11: 11,802,842	E71G	probably damaging	Het
Fnip2	A	C	3: 79,518,114	V58G	probably damaging	Het
Gapdhs	A	T	7: 30,731,924	I377N	probably damaging	Het
Gcn1l1	C	T	5: 115,595,300	A1059V	probably damaging	Het
Gm884	T	C	11: 103,616,893	I1416M	unknown	Het
Gpd1	G	A	15: 99,722,086	S255N	probably damaging	Het
Grik2	A	C	10: 49,419,696	I392S	probably damaging	Het
Hoxb3	T	C	11: 96,345,780	L228P	probably damaging	Het
Iws1	A	T	18: 32,090,515	M659L	probably benign	Het
Kmt2c	A	G	5: 25,375,366	C570R	probably benign	Het
Lamc3	T	A	2: 31,922,267		probably null	Het
Lipf	G	A	19: 33,965,648	G119R	probably damaging	Het
Magel2	A	T	7: 62,378,382	I345L	probably benign	Het
Mdn1	G	A	4: 32,722,360	A2381T	possibly damaging	Het
Med12l	T	C	3: 59,093,586	V690A	probably benign	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Mob3b	A	G	4: 35,083,872	Y106H	probably damaging	Het
Myo1c	T	C	11: 75,658,693	Y166H	probably damaging	Het
Ndst4	A	T	3: 125,570,844	H390L	probably benign	Het
Nt5c1b	T	A	12: 10,375,472	N280K	probably damaging	Het
Olfr1471	A	T	19: 13,445,888	N292I	probably damaging	Het
Olfr433	G	A	1: 174,042,334	R128H	probably benign	Het
Otof	A	G	5: 30,370,253	F1947L	probably damaging	Het
Pabpc4	G	A	4: 123,295,309	A481T	probably benign	Het
Parm1	C	T	5: 91,593,932	T53I	possibly damaging	Het
Pilra	C	T	5: 137,835,417	R129Q	probably benign	Het
Pkd1	C	T	17: 24,550,276	A5V	unknown	Het
Pmch	T	C	10: 88,091,380	S82P	probably benign	Het
Prf1	G	A	10: 61,300,155	R70H	possibly damaging	Het
Rad51c	T	C	11: 87,401,450	S180G	probably benign	Het
Rassf8	A	C	6: 145,815,247	T100P	probably damaging	Het
Rnpepl1	A	G	1: 92,917,168	E394G	probably damaging	Het
Rufy2	T	A	10: 63,002,993	V418E	probably benign	Het
Sdad1	A	T	5: 92,302,679	V199D	probably damaging	Het
Sptbn4	A	T	7: 27,364,336	S2227T	probably benign	Het
Tac4	A	G	11: 95,265,290	M66V	probably benign	Het
Tas2r126	T	C	6: 42,435,097	V188A	probably benign	Het
Tcerg1	T	C	18: 42,560,935	V707A	possibly damaging	Het
Trav13-4-dv7	G	A	14: 53,757,898	G103D	probably damaging	Het
Trav8d-1	A	G	14: 52,778,923	S89G	probably benign	Het
Vash1	T	C	12: 86,691,840	S354P	probably benign	Het
Vmn2r40	T	A	7: 8,908,117	I726F		Het
Vmn2r53	A	C	7: 12,606,491	N18K	probably damaging	Het
Wnt6	T	C	1: 74,784,263	F253S	probably damaging	Het
Zfp599	A	G	9: 22,250,515	I118T	probably benign	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GCACCAGTTTCTTGGGAGTC -3'
(R):5'- TTCCCTGAGATAGCAGAGGC -3'

Sequencing Primer
(F):5'- GAGTCCCATCCCAGCCAG -3'
(R):5'- ATAGCAGAGGCCAGGCTCTTC -3'

Posted On

2019-11-12