Incidental Mutation 'RF028:Catsper2'
ID604216
Institutional Source Beutler Lab
Gene Symbol Catsper2
Ensembl Gene ENSMUSG00000033486
Gene Namecation channel, sperm associated 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #RF028 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location121392631-121413792 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) ATCGCTTTCCTCGTTTTCG to ATCG at 121397726 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038073] [ENSMUST00000154604]
Predicted Effect probably benign
Transcript: ENSMUST00000038073
SMART Domains Protein: ENSMUSP00000037222
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:Ion_trans 105 350 1e-35 PFAM
low complexity region 422 447 N/A INTRINSIC
internal_repeat_1 450 473 3.72e-11 PROSPERO
internal_repeat_1 465 488 3.72e-11 PROSPERO
low complexity region 491 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154604
SMART Domains Protein: ENSMUSP00000119091
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. This gene is part of a tandem repeat on chromosome 15q15; the second copy of this gene is thought to be a pseudogene. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null male mice are infertile due to a sperm motility defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Catsper2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Catsper2 APN 2 121397892 splice site probably benign
IGL01830:Catsper2 APN 2 121407362 missense probably damaging 1.00
IGL03243:Catsper2 APN 2 121406819 missense probably benign 0.08
IGL03247:Catsper2 APN 2 121410200 missense probably benign 0.03
IGL03342:Catsper2 APN 2 121406736 missense probably damaging 0.99
FR4304:Catsper2 UTSW 2 121397542 nonsense probably null
FR4304:Catsper2 UTSW 2 121397782 utr 3 prime probably benign
FR4342:Catsper2 UTSW 2 121397793 utr 3 prime probably benign
FR4589:Catsper2 UTSW 2 121397779 utr 3 prime probably benign
FR4737:Catsper2 UTSW 2 121397540 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397542 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397779 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397782 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397795 utr 3 prime probably benign
R1463:Catsper2 UTSW 2 121406446 missense probably damaging 1.00
R1686:Catsper2 UTSW 2 121400042 critical splice donor site probably null
R2006:Catsper2 UTSW 2 121406357 nonsense probably null
R2163:Catsper2 UTSW 2 121400175 missense probably damaging 1.00
R4543:Catsper2 UTSW 2 121407409 nonsense probably null
R4888:Catsper2 UTSW 2 121397123 splice site probably null
R5121:Catsper2 UTSW 2 121397123 splice site probably null
R5323:Catsper2 UTSW 2 121406735 missense probably damaging 1.00
R5518:Catsper2 UTSW 2 121406363 missense possibly damaging 0.69
R5605:Catsper2 UTSW 2 121397052 missense possibly damaging 0.91
R6521:Catsper2 UTSW 2 121406807 missense probably damaging 1.00
R6531:Catsper2 UTSW 2 121399780 missense possibly damaging 0.67
R7055:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7138:Catsper2 UTSW 2 121397063 missense possibly damaging 0.85
R7240:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7247:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7686:Catsper2 UTSW 2 121397456 splice site probably null
R7952:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R8385:Catsper2 UTSW 2 121410140 missense possibly damaging 0.46
R8426:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
Z1176:Catsper2 UTSW 2 121407385 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAAGGAAAGCAGTATCGGCTG -3'
(R):5'- ATGTACAGAGGGACCAGTCTTG -3'

Sequencing Primer
(F):5'- CAGTATCGGCTGCAGTGGAG -3'
(R):5'- CAGTCTTGGAAAGGTCTCCG -3'
Posted On2019-12-04