Incidental Mutation 'R7848:Lrch4'
ID606727
Institutional Source Beutler Lab
Gene Symbol Lrch4
Ensembl Gene ENSMUSG00000093445
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms2810008P14Rik, LRN, LRRN4, 2900069C24Rik, SAP25
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137629121-137641099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137633854 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 124 (N124S)
Ref Sequence ENSEMBL: ENSMUSP00000031734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031734] [ENSMUST00000111002] [ENSMUST00000136028] [ENSMUST00000175968] [ENSMUST00000176011] [ENSMUST00000176667] [ENSMUST00000177477] [ENSMUST00000177545]
Predicted Effect probably damaging
Transcript: ENSMUST00000031734
AA Change: N124S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445
AA Change: N124S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111002
SMART Domains Protein: ENSMUSP00000106630
Gene: ENSMUSG00000089984

DomainStartEndE-ValueType
Pfam:RCC1 247 293 4.2e-11 PFAM
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136028
Predicted Effect probably damaging
Transcript: ENSMUST00000175968
AA Change: N70S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445
AA Change: N70S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176011
SMART Domains Protein: ENSMUSP00000135133
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176667
AA Change: N124S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445
AA Change: N124S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176871
Predicted Effect probably benign
Transcript: ENSMUST00000177477
AA Change: T76A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135724
Gene: ENSMUSG00000093445
AA Change: T76A

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177545
AA Change: N124S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720
AA Change: N124S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains leucine-rich repeats (LRR) at its amino terminus and that is known to be involved in ligand binding. The carboxyl terminus may act as a membrane anchor. Identified structural elements suggest that the encoded protein resembles a receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Lrch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrch4 APN 5 137637747 missense possibly damaging 0.49
IGL01862:Lrch4 APN 5 137637009 missense probably damaging 1.00
IGL03289:Lrch4 APN 5 137633577 missense probably damaging 1.00
R0144:Lrch4 UTSW 5 137638543 critical splice donor site probably null
R0724:Lrch4 UTSW 5 137637308 missense probably damaging 1.00
R1330:Lrch4 UTSW 5 137637789 missense probably damaging 0.99
R1557:Lrch4 UTSW 5 137637556 missense probably benign 0.00
R1694:Lrch4 UTSW 5 137638461 missense probably benign 0.00
R2358:Lrch4 UTSW 5 137638548 unclassified probably benign
R3755:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R3756:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R4608:Lrch4 UTSW 5 137639146 nonsense probably null
R5056:Lrch4 UTSW 5 137636851 missense probably damaging 1.00
R5114:Lrch4 UTSW 5 137637917 missense probably benign
R5181:Lrch4 UTSW 5 137629403 missense probably damaging 1.00
R5325:Lrch4 UTSW 5 137637906 missense probably damaging 1.00
R5430:Lrch4 UTSW 5 137638533 missense possibly damaging 0.46
R5712:Lrch4 UTSW 5 137637926 missense possibly damaging 0.57
R5846:Lrch4 UTSW 5 137633657 missense probably damaging 1.00
R5909:Lrch4 UTSW 5 137633865 missense possibly damaging 0.87
R7319:Lrch4 UTSW 5 137639715 missense
R7525:Lrch4 UTSW 5 137639465 missense probably damaging 1.00
R7761:Lrch4 UTSW 5 137639763 missense
R8209:Lrch4 UTSW 5 137639735 missense
R8226:Lrch4 UTSW 5 137639735 missense
RF009:Lrch4 UTSW 5 137637543 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTTGGGGAATCTTACAGC -3'
(R):5'- AGCTACTTGCCTTTCGTCCAAG -3'

Sequencing Primer
(F):5'- TGGGGAATCTTACAGCCCTCAC -3'
(R):5'- ACAAAGTCCCCAGGCCCTG -3'
Posted On2019-12-20