Incidental Mutation 'R7848:Zfp442'
ID 606713
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R7848 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150411226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 39 (N39D)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect possibly damaging
Transcript: ENSMUST00000109916
AA Change: N39D

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: N39D

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: N38D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: N38D

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9269:Zfp442 UTSW 2 150409367 missense probably benign 0.19
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9401:Zfp442 UTSW 2 150409695 missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150408748 missense unknown
R9711:Zfp442 UTSW 2 150408287 missense not run
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTCTTCAGGATTATGGTCTTCCC -3'
(R):5'- GCTGCCATTTCTCTTGCAAC -3'

Sequencing Primer
(F):5'- CTGTAGCCTAAATATAATGCCAGAG -3'
(R):5'- AACTCTTTATCCTATCCAAGGGGTG -3'
Posted On 2019-12-20