Incidental Mutation 'R8074:Srpk1'
ID620442
Institutional Source Beutler Lab
Gene Symbol Srpk1
Ensembl Gene ENSMUSG00000004865
Gene Nameserine/arginine-rich protein specific kinase 1
SynonymsSR protein-specific kinase 1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28587648-28622521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28622016 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 12 (K12T)
Ref Sequence ENSEMBL: ENSMUSP00000116259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114767] [ENSMUST00000130643]
Predicted Effect unknown
Transcript: ENSMUST00000114767
AA Change: K12T
Predicted Effect probably damaging
Transcript: ENSMUST00000130643
AA Change: K12T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116259
Gene: ENSMUSG00000004865
AA Change: K12T

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 229 6.8e-11 PFAM
Pfam:Pkinase 80 231 5.6e-23 PFAM
low complexity region 241 255 N/A INTRINSIC
coiled coil region 264 297 N/A INTRINSIC
Pfam:Pkinase 468 646 3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/arginine protein kinase specific for the SR (serine/arginine-rich domain) family of splicing factors. The protein localizes to the nucleus and the cytoplasm. It is thought to play a role in regulation of both constitutive and alternative splicing by regulating intracellular localization of splicing factors. Alternative splicing of this gene results in multiple transcript variants. Additional alternatively spliced transcript variants have been described for this gene, but their full length nature have not been determined.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Srpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Srpk1 APN 17 28606317 missense probably damaging 1.00
IGL01792:Srpk1 APN 17 28599467 splice site probably benign
IGL03153:Srpk1 APN 17 28592266 missense possibly damaging 0.57
H8562:Srpk1 UTSW 17 28602733 missense probably benign 0.32
R0481:Srpk1 UTSW 17 28590244 splice site probably benign
R1160:Srpk1 UTSW 17 28599774 missense probably benign 0.05
R2188:Srpk1 UTSW 17 28594189 missense probably damaging 1.00
R4640:Srpk1 UTSW 17 28608724 missense probably benign
R4716:Srpk1 UTSW 17 28622008 missense probably benign 0.16
R4880:Srpk1 UTSW 17 28591225 missense probably damaging 0.98
R5458:Srpk1 UTSW 17 28599472 splice site probably null
R5533:Srpk1 UTSW 17 28602759 missense probably damaging 1.00
R6383:Srpk1 UTSW 17 28590062 missense probably damaging 1.00
R6766:Srpk1 UTSW 17 28602753 missense possibly damaging 0.85
R7483:Srpk1 UTSW 17 28594218 missense probably benign 0.11
X0058:Srpk1 UTSW 17 28602835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCACATGATTCCCGGAG -3'
(R):5'- TGGTAGGCTCTGTGTTCACC -3'

Sequencing Primer
(F):5'- GGGCGAATCACACAGCG -3'
(R):5'- TGAAGCGGCGTCACTCTTG -3'
Posted On2020-01-23