Incidental Mutation 'R7584:Sec31b'
ID587006
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44543323 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000064900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect probably damaging
Transcript: ENSMUST00000063632
AA Change: D49G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: D49G

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111985
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166808
SMART Domains Protein: ENSMUSP00000126763
Gene: ENSMUSG00000091471

DomainStartEndE-ValueType
Pfam:NDUF_B8 1 71 1.5e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7983:Sec31b UTSW 19 44526230 missense probably damaging 1.00
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACATAACTCCTGTTCCCC -3'
(R):5'- TCCTTGCGGTTACCTCTAGAG -3'

Sequencing Primer
(F):5'- AACATAACTCCTGTTCCCCATACTTC -3'
(R):5'- CCTTGCGGTTACCTCTAGAGAAAAG -3'
Posted On2019-10-24