Incidental Mutation 'R8089:Fhad1'
ID629831
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8089 (G1)
Quality Score189.009
Status Validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141957660 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 456 (D456V)
Ref Sequence ENSEMBL: ENSMUSP00000101405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably damaging
Transcript: ENSMUST00000105779
AA Change: D456V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: D456V

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105780
AA Change: D456V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: D456V

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.7%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,274,039 V768I probably benign Het
Abcc8 G A 7: 46,108,356 T1323I probably benign Het
Adamtsl2 A G 2: 27,104,797 M828V probably benign Het
Agmo A G 12: 37,347,307 D153G probably benign Het
Akap13 T A 7: 75,610,592 V185D possibly damaging Het
Asic1 A G 15: 99,698,087 N414D probably damaging Het
Bin1 T A 18: 32,429,183 probably null Het
Ccar1 C A 10: 62,790,991 M1I probably null Het
Cdh26 T A 2: 178,457,577 probably null Het
Csmd3 C T 15: 47,669,207 D1620N Het
Dennd4a A T 9: 64,849,175 N204I probably damaging Het
Dgkb G A 12: 38,184,950 S438N probably damaging Het
Dmxl1 T C 18: 49,888,830 M1604T probably damaging Het
Gcfc2 C T 6: 81,925,790 T86M probably damaging Het
Idua T A 5: 108,681,780 M503K probably damaging Het
Ighm T C 12: 113,421,234 probably benign Het
Kdelc2 C T 9: 53,395,962 A402V probably benign Het
Kmt2d A T 15: 98,842,869 S4676T unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Map3k13 T C 16: 21,903,817 V243A possibly damaging Het
Moxd1 A G 10: 24,281,519 T350A probably benign Het
Nalcn A T 14: 123,299,960 W1175R probably damaging Het
Olfr197 T G 16: 59,185,710 I258L unknown Het
Olfr819 A T 10: 129,966,697 M1K probably null Het
Olfr943 T A 9: 39,184,631 V148E probably damaging Het
Pacsin2 A G 15: 83,379,696 I380T probably benign Het
Plcd1 A C 9: 119,075,992 C214G possibly damaging Het
Ptprm C A 17: 66,683,488 W1385L possibly damaging Het
Rab22a C T 2: 173,688,220 Q64* probably null Het
Rasa2 G T 9: 96,553,124 H604Q probably benign Het
Rasal1 G A 5: 120,671,578 G516D probably damaging Het
Rasgrp3 A T 17: 75,497,061 I120L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs12 T C 5: 35,020,348 I742T probably damaging Het
Scyl3 A G 1: 163,936,427 T121A possibly damaging Het
Six5 T G 7: 19,094,872 F79C probably damaging Het
Tbx3 G A 5: 119,680,569 R423H probably damaging Het
Terf2ip C T 8: 112,011,792 T104M probably benign Het
Tmem135 A G 7: 89,156,495 C234R probably damaging Het
Tnxb C G 17: 34,672,789 A702G unknown Het
Tspan1 T C 4: 116,164,335 K83R probably null Het
Ttc30b T C 2: 75,937,303 T369A possibly damaging Het
Ttn C T 2: 76,898,062 probably null Het
Usp5 A T 6: 124,820,410 probably null Het
Vmn1r27 T A 6: 58,215,209 Y270F possibly damaging Het
Vmn2r110 G A 17: 20,583,545 T256I probably benign Het
Zfp831 T A 2: 174,644,924 L464Q possibly damaging Het
Zscan4-ps3 C A 7: 11,612,732 H232N probably benign Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCTGTTGATGGGTGGAAC -3'
(R):5'- AAGCCTCATAAGCCAGCTTC -3'

Sequencing Primer
(F):5'- TGGAACACCCAGGCATCACG -3'
(R):5'- GCCAGCTTCCTCACCAG -3'
Posted On2020-06-30