Incidental Mutation 'R8135:Sipa1l1'
ID632227
Institutional Source Beutler Lab
Gene Symbol Sipa1l1
Ensembl Gene ENSMUSG00000042700
Gene Namesignal-induced proliferation-associated 1 like 1
Synonyms4931426N11Rik, Spar
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location82169320-82451786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82341301 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 100 (I100M)
Ref Sequence ENSEMBL: ENSMUSP00000131030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053969] [ENSMUST00000166429] [ENSMUST00000220963] [ENSMUST00000222298] [ENSMUST00000222714]
Predicted Effect probably benign
Transcript: ENSMUST00000053969
AA Change: I100M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061014
Gene: ENSMUSG00000042700
AA Change: I100M

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 810 8.9e-70 PFAM
PDZ 962 1028 2.63e-9 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:SPAR_C 1483 1727 4.4e-86 PFAM
low complexity region 1731 1746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166429
AA Change: I100M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131030
Gene: ENSMUSG00000042700
AA Change: I100M

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 816 1.3e-64 PFAM
PDZ 962 1028 1.3e-11 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:DUF3401 1483 1727 1.8e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220963
AA Change: I100M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222298
AA Change: I100M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222714
AA Change: I100M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Sipa1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Sipa1l1 APN 12 82387696 missense probably benign 0.06
IGL01478:Sipa1l1 APN 12 82446898 missense probably benign 0.00
IGL01620:Sipa1l1 APN 12 82422489 missense probably damaging 0.97
IGL02496:Sipa1l1 APN 12 82425094 missense probably damaging 1.00
IGL02550:Sipa1l1 APN 12 82440949 nonsense probably null
IGL02689:Sipa1l1 APN 12 82440820 missense probably benign 0.01
IGL02706:Sipa1l1 APN 12 82397433 missense possibly damaging 0.95
IGL02995:Sipa1l1 APN 12 82357331 missense probably benign 0.39
IGL03104:Sipa1l1 APN 12 82342130 missense probably benign 0.05
IGL03295:Sipa1l1 APN 12 82432940 missense probably damaging 1.00
bullae UTSW 12 82342250 missense probably damaging 1.00
bullish UTSW 12 82422471 nonsense probably null
ebullient UTSW 12 82341672 missense probably benign 0.18
PIT4431001:Sipa1l1 UTSW 12 82396516 missense probably benign 0.34
R0140:Sipa1l1 UTSW 12 82396200 missense probably damaging 1.00
R0348:Sipa1l1 UTSW 12 82384756 critical splice donor site probably null
R0534:Sipa1l1 UTSW 12 82425280 missense possibly damaging 0.94
R0538:Sipa1l1 UTSW 12 82425099 missense probably benign 0.00
R0547:Sipa1l1 UTSW 12 82437736 missense probably benign
R0980:Sipa1l1 UTSW 12 82342220 missense possibly damaging 0.60
R1051:Sipa1l1 UTSW 12 82449345 missense possibly damaging 0.48
R1244:Sipa1l1 UTSW 12 82425416 missense probably benign 0.00
R1473:Sipa1l1 UTSW 12 82341111 missense probably damaging 1.00
R1508:Sipa1l1 UTSW 12 82440893 missense probably damaging 1.00
R1563:Sipa1l1 UTSW 12 82341161 missense probably benign 0.31
R1671:Sipa1l1 UTSW 12 82397461 missense probably damaging 1.00
R1935:Sipa1l1 UTSW 12 82372434 missense probably damaging 1.00
R1950:Sipa1l1 UTSW 12 82341459 missense probably damaging 0.98
R2191:Sipa1l1 UTSW 12 82396691 nonsense probably null
R2249:Sipa1l1 UTSW 12 82342116 missense probably benign
R2909:Sipa1l1 UTSW 12 82357331 missense probably benign 0.39
R4012:Sipa1l1 UTSW 12 82341782 missense possibly damaging 0.86
R4154:Sipa1l1 UTSW 12 82425214 missense possibly damaging 0.95
R4382:Sipa1l1 UTSW 12 82446822 missense possibly damaging 0.46
R4448:Sipa1l1 UTSW 12 82341750 missense probably benign 0.15
R4651:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4652:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4751:Sipa1l1 UTSW 12 82341194 missense probably benign
R4755:Sipa1l1 UTSW 12 82372386 missense possibly damaging 0.74
R4888:Sipa1l1 UTSW 12 82342333 missense probably damaging 0.96
R4912:Sipa1l1 UTSW 12 82396678 missense possibly damaging 0.89
R4937:Sipa1l1 UTSW 12 82341329 missense probably benign 0.01
R5068:Sipa1l1 UTSW 12 82437827 missense probably damaging 1.00
R5113:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5114:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5240:Sipa1l1 UTSW 12 82341588 missense possibly damaging 0.92
R6041:Sipa1l1 UTSW 12 82342250 missense probably damaging 1.00
R6048:Sipa1l1 UTSW 12 82440869 missense probably benign 0.03
R6170:Sipa1l1 UTSW 12 82341672 missense probably benign 0.18
R6185:Sipa1l1 UTSW 12 82425028 missense probably damaging 1.00
R6326:Sipa1l1 UTSW 12 82372468 missense probably damaging 1.00
R6842:Sipa1l1 UTSW 12 82420546 missense probably benign 0.00
R7008:Sipa1l1 UTSW 12 82363112 missense probably damaging 0.99
R7058:Sipa1l1 UTSW 12 82403122 missense probably benign 0.00
R7069:Sipa1l1 UTSW 12 82341406 missense probably damaging 0.99
R7122:Sipa1l1 UTSW 12 82422462 missense possibly damaging 0.79
R7310:Sipa1l1 UTSW 12 82372495 missense probably damaging 1.00
R7469:Sipa1l1 UTSW 12 82420664 critical splice donor site probably null
R7718:Sipa1l1 UTSW 12 82342497 missense probably damaging 1.00
R7787:Sipa1l1 UTSW 12 82449988 missense possibly damaging 0.81
R7844:Sipa1l1 UTSW 12 82397493 missense probably damaging 1.00
R7893:Sipa1l1 UTSW 12 82341568 missense probably benign 0.00
R7953:Sipa1l1 UTSW 12 82449926 missense probably damaging 1.00
R8043:Sipa1l1 UTSW 12 82449926 missense probably damaging 1.00
R8099:Sipa1l1 UTSW 12 82433826 missense probably benign 0.08
R8229:Sipa1l1 UTSW 12 82437848 missense probably damaging 1.00
R8348:Sipa1l1 UTSW 12 82396271 missense probably benign 0.13
R8388:Sipa1l1 UTSW 12 82169485 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCAGCCTAGGATCATCAG -3'
(R):5'- TATCACTGTTGCTGCGCTGC -3'

Sequencing Primer
(F):5'- ATCATCAGTCATGGCTGCAG -3'
(R):5'- CCGAATTCTGCGAAGGGCTTTC -3'
Posted On2020-06-30