Incidental Mutation 'R8135:Tecpr1'
ID632217
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144198602 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1011 (D1011V)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060747] [ENSMUST00000085701]
Predicted Effect probably benign
Transcript: ENSMUST00000060747
SMART Domains Protein: ENSMUSP00000055493
Gene: ENSMUSG00000052271

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 41 67 N/A INTRINSIC
HLH 78 130 1.61e-18 SMART
low complexity region 136 148 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085701
AA Change: D1011V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: D1011V

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCCTGCAAATCCTGGCAAAG -3'
(R):5'- TTGAGTCTCAGCCTCAGAGG -3'

Sequencing Primer
(F):5'- TCTGGTGGAGAAGCCCAACTC -3'
(R):5'- TCTCAGCCTCAGAGGAGAGAG -3'
Posted On2020-06-30