Mutagenetix > Incidental Mutation

Incidental Mutation 'R8135:Tecpr1'

632217

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

067563-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8135 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144198602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1011 (D1011V)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060747] [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably benign
Transcript: ENSMUST00000060747

SMART Domains

Protein: ENSMUSP00000055493
Gene: ENSMUSG00000052271

Domain	Start	End	E-Value	Type
low complexity region	6	13	N/A	INTRINSIC
low complexity region	41	67	N/A	INTRINSIC
HLH	78	130	1.61e-18	SMART
low complexity region	136	148	N/A	INTRINSIC
low complexity region	151	166	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085701
AA Change: D1011V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: D1011V

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,696,995	I420V	probably benign	Het
Adam7	A	T	14: 68,516,573	M359K	probably damaging	Het
Adra1d	C	T	2: 131,561,772	A133T	probably damaging	Het
B3galnt2	T	A	13: 13,970,869		probably null	Het
Camk1g	A	G	1: 193,354,027	V175A	possibly damaging	Het
Cfi	A	G	3: 129,855,000	N178D	probably benign	Het
Csf2rb	T	A	15: 78,348,119	I542K	possibly damaging	Het
Ctsz	T	C	2: 174,429,153	T183A	probably benign	Het
Dhx8	A	G	11: 101,738,264	D213G	unknown	Het
Dph7	T	C	2: 24,969,544	I271T	probably benign	Het
Edem1	G	T	6: 108,829,061	E108*	probably null	Het
Enpp4	T	C	17: 44,101,335	T328A	probably benign	Het
Fasl	A	G	1: 161,787,128	V122A	probably benign	Het
Fut2	T	C	7: 45,651,142	T69A	probably damaging	Het
Gaa	T	C	11: 119,278,384		probably null	Het
Galnt5	T	A	2: 58,014,868	V481D	probably damaging	Het
Gsdma2	A	G	11: 98,652,046	I211V	probably benign	Het
H2-M10.4	T	C	17: 36,461,770	T107A	probably benign	Het
Iqcg	T	A	16: 33,029,024	K297N	probably benign	Het
Map2	A	G	1: 66,413,669	T573A	probably damaging	Het
Nhsl1	A	G	10: 18,531,432	D1438G	probably damaging	Het
Nipal2	A	T	15: 34,678,573	Y41N	possibly damaging	Het
Obscn	A	T	11: 59,031,877	S5878T	possibly damaging	Het
Pde6a	T	C	18: 61,285,925	F791L	probably damaging	Het
Phip	A	T	9: 82,930,374	N308K	probably benign	Het
Pigc	A	G	1: 161,970,565	K39E	possibly damaging	Het
Robo2	T	G	16: 73,933,160	I1050L	probably benign	Het
Rps2	A	G	17: 24,720,435	K54E	probably benign	Het
Set	T	A	2: 30,069,427	D137E	probably benign	Het
Sipa1l1	A	G	12: 82,341,301	I100M	probably benign	Het
Spdye4b	T	C	5: 143,195,022	V81A	probably damaging	Het
Tbc1d2	T	C	4: 46,609,071	D722G	probably benign	Het
Unc80	A	T	1: 66,509,287	I573F	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,603	C277S	probably benign	Het
Vwa1	T	A	4: 155,772,894	D149V	probably damaging	Het
Zfp397	T	A	18: 23,956,507	V23E	probably damaging	Het
Zmynd8	T	C	2: 165,812,426	D722G	probably damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCCTGCAAATCCTGGCAAAG -3'
(R):5'- TTGAGTCTCAGCCTCAGAGG -3'

Sequencing Primer
(F):5'- TCTGGTGGAGAAGCCCAACTC -3'
(R):5'- TCTCAGCCTCAGAGGAGAGAG -3'

Posted On

2020-06-30