Mutagenetix > Incidental Mutation

Incidental Mutation 'R8094:Dsg2'

630120

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.266) question?

Stock #

R8094 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 20583004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]

AlphaFold

O55111

Predicted Effect

probably damaging
Transcript: ENSMUST00000059787
AA Change: D304G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: D304G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120102
AA Change: D304G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: D304G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
Pfam:Cadherin	282	347	6.9e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121837

SMART Domains

Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART

Meta Mutation Damage Score

0.8998

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	T	A	8: 12,279,824	L93H	unknown	Het
A2ml1	A	G	6: 128,572,082	Y246H	probably damaging	Het
Akap11	C	A	14: 78,512,973	C658F		Het
Akap2	A	G	4: 57,886,319	T859A	possibly damaging	Het
Arid2	T	G	15: 96,368,711	S547A	possibly damaging	Het
Atf1	C	A	15: 100,245,289	D46E	probably damaging	Het
Brca2	T	A	5: 150,536,169	F303Y	possibly damaging	Het
Btbd18	T	A	2: 84,667,916	S633T	possibly damaging	Het
Btg4	T	G	9: 51,119,145	F182V	probably benign	Het
Cacna1e	G	A	1: 154,561,770	S340F	probably damaging	Het
Camta2	A	G	11: 70,686,077	W41R	probably damaging	Het
Cbl	A	T	9: 44,163,399	D455E	probably benign	Het
Ccdc162	A	T	10: 41,612,868	D1208E	probably benign	Het
Cd177	A	T	7: 24,744,417	M752K	probably damaging	Het
Cep290	A	T	10: 100,544,931	H100L	possibly damaging	Het
Chrnb2	T	A	3: 89,761,391	I206F	probably damaging	Het
Cyp2c40	A	G	19: 39,802,565	L274S	probably benign	Het
Cyp2c40	T	A	19: 39,802,571	Y272F	probably benign	Het
Cyp2d22	C	A	15: 82,374,355	A102S	probably benign	Het
Cyp51	C	T	5: 4,086,490	E435K	probably benign	Het
Dchs2	T	C	3: 83,355,622	F3066L	probably benign	Het
Disp1	C	A	1: 183,087,628	R1076L	probably damaging	Het
Dkk2	C	T	3: 132,086,040	A3V	probably benign	Het
Dnah7b	T	C	1: 46,126,804	F543S	probably benign	Het
Dpt	A	T	1: 164,796,912	S61C	probably damaging	Het
Drg2	A	T	11: 60,462,270	Y243F	probably damaging	Het
Dst	T	G	1: 34,188,959	L1878V	possibly damaging	Het
F5	A	G	1: 164,208,940	Y1890C	probably benign	Het
Fat1	T	C	8: 44,952,702	V830A	probably damaging	Het
Fat2	C	T	11: 55,296,139	D1294N	probably benign	Het
Fbxo15	A	G	18: 84,965,493	Y322C	probably benign	Het
Fhit	A	T	14: 10,751,666	N7K	unknown	Het
Fuk	A	G	8: 110,895,972	F108S	probably damaging	Het
Gabrb2	A	G	11: 42,597,543	I279V	probably damaging	Het
Galk2	T	C	2: 125,931,269	F207S	probably damaging	Het
Gm16486	T	C	8: 70,709,418	V420A	probably benign	Het
Gtpbp3	C	T	8: 71,488,836	L17F	possibly damaging	Het
Gucy2c	T	A	6: 136,737,448	D460V	probably benign	Het
Herc1	G	A	9: 66,493,180	V4329I	probably damaging	Het
Kirrel3	G	A	9: 35,035,164	V740M	probably damaging	Het
Macf1	C	A	4: 123,369,867	V6956L	probably damaging	Het
Mill1	C	T	7: 18,255,910	A39V	probably benign	Het
Mkln1	T	A	6: 31,492,653	Y599*	probably null	Het
Mrpl14	T	A	17: 45,698,113	L46Q	possibly damaging	Het
Myom2	G	T	8: 15,069,418	R103L	possibly damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ndst2	A	T	14: 20,728,164	V449D	probably damaging	Het
Nell1	T	A	7: 50,120,587	H131Q	probably benign	Het
Nos3	G	C	5: 24,367,220	R97P	probably benign	Het
Npc1	A	T	18: 12,194,240	F1099L	probably benign	Het
Nxpe5	T	A	5: 138,251,540	W531R	probably damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1215	T	C	2: 89,002,368		probably benign	Het
Olfr1450	A	T	19: 12,954,002	T138S	probably benign	Het
Olfr3	A	T	2: 36,812,318	L258H	probably damaging	Het
Olfr800	A	G	10: 129,660,064	D86G	probably damaging	Het
Osmr	T	C	15: 6,815,621	N889S	possibly damaging	Het
Oxct2b	A	G	4: 123,116,508	I74V	possibly damaging	Het
Phldb3	C	A	7: 24,626,709	A572D	probably damaging	Het
Pigr	A	G	1: 130,846,510	E409G	probably damaging	Het
Ptprs	T	C	17: 56,428,947	E674G	probably benign	Het
Ptpru	G	A	4: 131,793,592	T801I	possibly damaging	Het
Ralgapa1	T	A	12: 55,782,846	D200V	probably damaging	Het
Rb1cc1	A	T	1: 6,263,224	R1429*	probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnpep	A	T	1: 135,283,776	L78Q	probably damaging	Het
Rtn2	A	T	7: 19,293,866	I394F	probably damaging	Het
Satb2	A	T	1: 56,831,464	V572D	possibly damaging	Het
Sds	T	C	5: 120,478,936		probably benign	Het
Serpina10	TTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCC	12: 103,628,773		probably benign	Het
Sgo2a	T	C	1: 58,017,141	I828T	possibly damaging	Het
Slc25a33	T	A	4: 149,756,152	K79N	probably benign	Het
Slc25a51	A	C	4: 45,399,783	F136V	probably benign	Het
Slfn14	T	A	11: 83,283,293	K291*	probably null	Het
Sp100	A	G	1: 85,697,098	K403E	possibly damaging	Het
Spaca1	C	T	4: 34,049,837	E54K	possibly damaging	Het
Sympk	T	G	7: 19,053,448		probably null	Het
Syne1	A	T	10: 5,117,031	V7078D	probably damaging	Het
Tas2r121	T	A	6: 132,700,809	I67L	probably benign	Het
Tha1	T	C	11: 117,868,497	K389E	probably benign	Het
Thbs2	T	A	17: 14,680,322	Q541L	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmem94	T	C	11: 115,788,392		probably null	Het
Tnfsf13	A	G	11: 69,685,157	C35R	probably damaging	Het
Trcg1	C	A	9: 57,242,281	Q379K	probably benign	Het
Ubr4	T	C	4: 139,440,696	S1507P	probably damaging	Het
Uckl1	A	G	2: 181,573,256	I268T	probably damaging	Het
Uvrag	T	C	7: 98,991,967	K289E	possibly damaging	Het
Vmn2r104	C	A	17: 20,030,221	C596F	possibly damaging	Het
Vmn2r11	A	T	5: 109,053,760	F293I	probably damaging	Het
Vps13b	T	A	15: 35,668,906		probably null	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zscan4f	T	A	7: 11,401,227	C187S	possibly damaging	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1543:Dsg2	UTSW	18	20594211	missense	probably benign	0.33
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1946:Dsg2	UTSW	18	20580548	missense	probably damaging	1.00
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R1992:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably benign
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2343:Dsg2	UTSW	18	20602298	missense	probably damaging	0.99
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08
R7558:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R8118:Dsg2	UTSW	18	20582801	missense	probably benign	0.11
R8157:Dsg2	UTSW	18	20580549	missense	probably damaging	1.00
R8307:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8308:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8488:Dsg2	UTSW	18	20601374	missense	probably damaging	1.00
R8520:Dsg2	UTSW	18	20579451	missense	probably damaging	1.00
R8669:Dsg2	UTSW	18	20590075	missense	probably damaging	1.00
R8675:Dsg2	UTSW	18	20601918	missense	possibly damaging	0.75
R8750:Dsg2	UTSW	18	20575012	missense	possibly damaging	0.90
R8773:Dsg2	UTSW	18	20582999	missense	probably damaging	1.00
R8888:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8895:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8912:Dsg2	UTSW	18	20582821	missense	probably damaging	1.00
R8925:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R8927:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R9263:Dsg2	UTSW	18	20594166	missense	probably benign	0.33
R9328:Dsg2	UTSW	18	20582790	missense	possibly damaging	0.81
Z1176:Dsg2	UTSW	18	20580621	missense	probably damaging	1.00
Z1177:Dsg2	UTSW	18	20602249	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCAAGCTCAAGTTCAGATC -3'
(R):5'- AGCACCTGTGAGAGTATGGG -3'

Sequencing Primer
(F):5'- GCTCAAGTTCAGATCCGTATATTGG -3'
(R):5'- GGGACTCAAAGCATGTTAGTCTTTCC -3'

Posted On

2020-06-30