Incidental Mutation 'R8168:Prdm10'
ID633910
Institutional Source Beutler Lab
Gene Symbol Prdm10
Ensembl Gene ENSMUSG00000042496
Gene NamePR domain containing 10
Synonymstristanin, LOC382066
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8168 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location31280538-31381723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31346967 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 514 (A514T)
Ref Sequence ENSEMBL: ENSMUSP00000074104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074510]
Predicted Effect probably benign
Transcript: ENSMUST00000074510
AA Change: A514T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: A514T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 111 117 N/A INTRINSIC
PDB:3IHX|D 133 284 1e-104 PDB
Blast:SET 165 277 3e-32 BLAST
ZnF_C2H2 300 322 5.42e-2 SMART
Pfam:Tristanin_u2 325 455 2.4e-49 PFAM
ZnF_C2H2 471 493 7.78e-3 SMART
ZnF_C2H2 501 523 1.95e-3 SMART
ZnF_C2H2 529 551 3.83e-2 SMART
ZnF_C2H2 557 580 8.34e-3 SMART
ZnF_C2H2 585 607 3.21e-4 SMART
ZnF_C2H2 613 636 3.69e-4 SMART
ZnF_C2H2 668 691 8.22e-2 SMART
ZnF_C2H2 801 824 1.25e-1 SMART
low complexity region 904 916 N/A INTRINSIC
low complexity region 956 964 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1110 1122 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
9430020K01Rik A T 18: 4,675,094 D952V probably benign Het
AI607873 A C 1: 173,729,938 S411R probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfrp2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Raph1 A G 1: 60,499,620 C389R unknown Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tex40 A G 19: 6,922,652 S162P possibly damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Prdm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Prdm10 APN 9 31360812 splice site probably benign
IGL00485:Prdm10 APN 9 31327546 missense possibly damaging 0.87
IGL00757:Prdm10 APN 9 31318546 missense possibly damaging 0.69
IGL00836:Prdm10 APN 9 31329869 splice site probably benign
IGL01505:Prdm10 APN 9 31327282 missense probably benign
IGL01594:Prdm10 APN 9 31346853 missense probably damaging 1.00
IGL01894:Prdm10 APN 9 31316261 missense probably damaging 1.00
IGL01927:Prdm10 APN 9 31335398 splice site probably benign
IGL02053:Prdm10 APN 9 31360848 missense probably benign 0.00
IGL02068:Prdm10 APN 9 31337350 missense probably damaging 1.00
IGL02295:Prdm10 APN 9 31362368 missense probably benign
IGL02390:Prdm10 APN 9 31353389 missense possibly damaging 0.68
IGL02574:Prdm10 APN 9 31357293 missense probably damaging 1.00
IGL02636:Prdm10 APN 9 31329681 missense possibly damaging 0.68
IGL02883:Prdm10 APN 9 31327348 missense probably damaging 0.99
IGL03057:Prdm10 APN 9 31349185 missense probably damaging 1.00
PIT4142001:Prdm10 UTSW 9 31325767 missense probably benign 0.00
R0089:Prdm10 UTSW 9 31316230 missense probably damaging 1.00
R0149:Prdm10 UTSW 9 31316159 splice site probably benign
R0306:Prdm10 UTSW 9 31316224 missense probably damaging 1.00
R0386:Prdm10 UTSW 9 31316300 missense probably damaging 1.00
R0390:Prdm10 UTSW 9 31349268 critical splice donor site probably null
R1512:Prdm10 UTSW 9 31337401 missense probably damaging 1.00
R1528:Prdm10 UTSW 9 31357286 missense probably damaging 1.00
R2409:Prdm10 UTSW 9 31349122 missense possibly damaging 0.81
R3745:Prdm10 UTSW 9 31340407 missense possibly damaging 0.72
R3929:Prdm10 UTSW 9 31347136 missense probably damaging 1.00
R4295:Prdm10 UTSW 9 31316294 missense possibly damaging 0.94
R4629:Prdm10 UTSW 9 31337316 nonsense probably null
R4660:Prdm10 UTSW 9 31327328 missense probably damaging 1.00
R4758:Prdm10 UTSW 9 31362412 missense probably benign 0.00
R4793:Prdm10 UTSW 9 31353405 missense probably damaging 1.00
R4798:Prdm10 UTSW 9 31341273 missense probably damaging 1.00
R4806:Prdm10 UTSW 9 31329941 makesense probably null
R4865:Prdm10 UTSW 9 31347080 missense probably damaging 1.00
R5068:Prdm10 UTSW 9 31359047 missense probably damaging 0.96
R5093:Prdm10 UTSW 9 31341483 missense probably damaging 1.00
R5162:Prdm10 UTSW 9 31340418 missense possibly damaging 0.90
R5656:Prdm10 UTSW 9 31353417 missense probably benign 0.08
R5855:Prdm10 UTSW 9 31337323 missense probably damaging 1.00
R6242:Prdm10 UTSW 9 31341252 missense possibly damaging 0.67
R6396:Prdm10 UTSW 9 31318546 missense possibly damaging 0.69
R6970:Prdm10 UTSW 9 31329823 nonsense probably null
R7165:Prdm10 UTSW 9 31316442 splice site probably null
R7177:Prdm10 UTSW 9 31367707 missense probably benign
R7201:Prdm10 UTSW 9 31316306 missense possibly damaging 0.87
R7313:Prdm10 UTSW 9 31357160 nonsense probably null
R7337:Prdm10 UTSW 9 31316241 missense probably damaging 1.00
R7511:Prdm10 UTSW 9 31378481 missense probably damaging 1.00
R7711:Prdm10 UTSW 9 31357232 missense probably damaging 1.00
R7855:Prdm10 UTSW 9 31327474 missense probably benign 0.04
R7965:Prdm10 UTSW 9 31347006 missense probably damaging 1.00
R7997:Prdm10 UTSW 9 31353425 missense probably damaging 1.00
RF004:Prdm10 UTSW 9 31359126 missense probably damaging 1.00
X0064:Prdm10 UTSW 9 31362451 missense probably damaging 1.00
Z1176:Prdm10 UTSW 9 31316168 missense possibly damaging 0.95
Z1176:Prdm10 UTSW 9 31316293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGAACTGCAGGCGTCAC -3'
(R):5'- GACACTCACCTGGATAAAATCTGG -3'

Sequencing Primer
(F):5'- GTGTCTTTCAGAATGCAGCTC -3'
(R):5'- GGAACCGTTTCTTACAAGTTGGGC -3'
Posted On2020-07-13