Mutagenetix > Incidental Mutations

Incidental Mutation 'R8168:Prdm10'

633910

Institutional Source

Beutler Lab

Gene Symbol

Prdm10

Ensembl Gene

ENSMUSG00000042496

Gene Name

PR domain containing 10

Synonyms

tristanin, LOC382066

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8168 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31280538-31381723 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31346967 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 514 (A514T)

Ref Sequence

ENSEMBL: ENSMUSP00000074104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074510]

Predicted Effect

probably benign
Transcript: ENSMUST00000074510
AA Change: A514T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: A514T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	111	117	N/A	INTRINSIC
PDB:3IHX\|D	133	284	1e-104	PDB
Blast:SET	165	277	3e-32	BLAST
ZnF_C2H2	300	322	5.42e-2	SMART
Pfam:Tristanin_u2	325	455	2.4e-49	PFAM
ZnF_C2H2	471	493	7.78e-3	SMART
ZnF_C2H2	501	523	1.95e-3	SMART
ZnF_C2H2	529	551	3.83e-2	SMART
ZnF_C2H2	557	580	8.34e-3	SMART
ZnF_C2H2	585	607	3.21e-4	SMART
ZnF_C2H2	613	636	3.69e-4	SMART
ZnF_C2H2	668	691	8.22e-2	SMART
ZnF_C2H2	801	824	1.25e-1	SMART
low complexity region	904	916	N/A	INTRINSIC
low complexity region	956	964	N/A	INTRINSIC
low complexity region	988	1007	N/A	INTRINSIC
low complexity region	1110	1122	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,982,944	A150T	probably benign	Het
9430020K01Rik	A	T	18: 4,675,094	D952V	probably benign	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Ano4	A	G	10: 88,980,995	I652T	probably damaging	Het
Arhgef1	A	G	7: 24,925,406	T862A	probably benign	Het
Atp6v1b2	T	C	8: 69,108,331	S404P	possibly damaging	Het
Cfap54	A	T	10: 92,908,877	S2170T	unknown	Het
Copa	A	T	1: 172,099,672	H204L	probably damaging	Het
Cwc22	A	C	2: 77,927,271	V171G	probably damaging	Het
D230025D16Rik	C	T	8: 105,248,769	P330L	probably benign	Het
Dock5	A	T	14: 67,770,197		probably null	Het
Flrt1	G	A	19: 7,096,637	L182F	probably damaging	Het
Foxf1	T	C	8: 121,085,162	V255A	probably damaging	Het
Gnptab	G	T	10: 88,419,133	A194S	probably benign	Het
Gzf1	C	T	2: 148,684,766	R386C	probably damaging	Het
H2-Aa	T	A	17: 34,287,721	T16S	possibly damaging	Het
Hdgfrp2	T	C	17: 56,082,282	F52S	probably damaging	Het
Htt	A	G	5: 34,882,956	N2154S	probably benign	Het
Lama3	T	A	18: 12,506,942	W65R	probably null	Het
Mef2c	G	T	13: 83,656,350	L356F	probably damaging	Het
Mrgprb2	A	T	7: 48,552,019	S319R	probably benign	Het
Mtrr	C	T	13: 68,572,613	V288I	probably benign	Het
Myo18a	T	A	11: 77,821,142	I713N	probably damaging	Het
Nelfa	A	T	5: 33,921,907	N107K	possibly damaging	Het
Nim1k	A	T	13: 119,712,752	V202D	probably damaging	Het
Nlrc4	T	C	17: 74,445,211	T726A	probably benign	Het
Olfr1154	T	A	2: 87,903,199	H159L	probably damaging	Het
Olfr1208	T	A	2: 88,896,776	M274L	probably benign	Het
Prg4	T	A	1: 150,455,850	E357D	unknown	Het
Ptp4a3	T	G	15: 73,756,846	Y152D	probably damaging	Het
Raph1	A	G	1: 60,499,620	C389R	unknown	Het
Rcc1	T	C	4: 132,335,785	E170G	probably benign	Het
Spag17	C	T	3: 100,034,984	T775M	possibly damaging	Het
Srcap	T	A	7: 127,542,523	V1825D	probably damaging	Het
Tex40	A	G	19: 6,922,652	S162P	possibly damaging	Het
Tshr	T	A	12: 91,511,965	H195Q	probably benign	Het
Vmn1r174	A	T	7: 23,754,671	D254V	probably damaging	Het
Vps13a	A	C	19: 16,749,548	I244M	probably benign	Het

Other mutations in Prdm10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Prdm10	APN	9	31360812	splice site	probably benign
IGL00485:Prdm10	APN	9	31327546	missense	possibly damaging	0.87
IGL00757:Prdm10	APN	9	31318546	missense	possibly damaging	0.69
IGL00836:Prdm10	APN	9	31329869	splice site	probably benign
IGL01505:Prdm10	APN	9	31327282	missense	probably benign
IGL01594:Prdm10	APN	9	31346853	missense	probably damaging	1.00
IGL01894:Prdm10	APN	9	31316261	missense	probably damaging	1.00
IGL01927:Prdm10	APN	9	31335398	splice site	probably benign
IGL02053:Prdm10	APN	9	31360848	missense	probably benign	0.00
IGL02068:Prdm10	APN	9	31337350	missense	probably damaging	1.00
IGL02295:Prdm10	APN	9	31362368	missense	probably benign
IGL02390:Prdm10	APN	9	31353389	missense	possibly damaging	0.68
IGL02574:Prdm10	APN	9	31357293	missense	probably damaging	1.00
IGL02636:Prdm10	APN	9	31329681	missense	possibly damaging	0.68
IGL02883:Prdm10	APN	9	31327348	missense	probably damaging	0.99
IGL03057:Prdm10	APN	9	31349185	missense	probably damaging	1.00
PIT4142001:Prdm10	UTSW	9	31325767	missense	probably benign	0.00
R0089:Prdm10	UTSW	9	31316230	missense	probably damaging	1.00
R0149:Prdm10	UTSW	9	31316159	splice site	probably benign
R0306:Prdm10	UTSW	9	31316224	missense	probably damaging	1.00
R0386:Prdm10	UTSW	9	31316300	missense	probably damaging	1.00
R0390:Prdm10	UTSW	9	31349268	critical splice donor site	probably null
R1512:Prdm10	UTSW	9	31337401	missense	probably damaging	1.00
R1528:Prdm10	UTSW	9	31357286	missense	probably damaging	1.00
R2409:Prdm10	UTSW	9	31349122	missense	possibly damaging	0.81
R3745:Prdm10	UTSW	9	31340407	missense	possibly damaging	0.72
R3929:Prdm10	UTSW	9	31347136	missense	probably damaging	1.00
R4295:Prdm10	UTSW	9	31316294	missense	possibly damaging	0.94
R4629:Prdm10	UTSW	9	31337316	nonsense	probably null
R4660:Prdm10	UTSW	9	31327328	missense	probably damaging	1.00
R4758:Prdm10	UTSW	9	31362412	missense	probably benign	0.00
R4793:Prdm10	UTSW	9	31353405	missense	probably damaging	1.00
R4798:Prdm10	UTSW	9	31341273	missense	probably damaging	1.00
R4806:Prdm10	UTSW	9	31329941	makesense	probably null
R4865:Prdm10	UTSW	9	31347080	missense	probably damaging	1.00
R5068:Prdm10	UTSW	9	31359047	missense	probably damaging	0.96
R5093:Prdm10	UTSW	9	31341483	missense	probably damaging	1.00
R5162:Prdm10	UTSW	9	31340418	missense	possibly damaging	0.90
R5656:Prdm10	UTSW	9	31353417	missense	probably benign	0.08
R5855:Prdm10	UTSW	9	31337323	missense	probably damaging	1.00
R6242:Prdm10	UTSW	9	31341252	missense	possibly damaging	0.67
R6396:Prdm10	UTSW	9	31318546	missense	possibly damaging	0.69
R6970:Prdm10	UTSW	9	31329823	nonsense	probably null
R7165:Prdm10	UTSW	9	31316442	splice site	probably null
R7177:Prdm10	UTSW	9	31367707	missense	probably benign
R7201:Prdm10	UTSW	9	31316306	missense	possibly damaging	0.87
R7313:Prdm10	UTSW	9	31357160	nonsense	probably null
R7337:Prdm10	UTSW	9	31316241	missense	probably damaging	1.00
R7511:Prdm10	UTSW	9	31378481	missense	probably damaging	1.00
R7711:Prdm10	UTSW	9	31357232	missense	probably damaging	1.00
R7855:Prdm10	UTSW	9	31327474	missense	probably benign	0.04
R7965:Prdm10	UTSW	9	31347006	missense	probably damaging	1.00
R7997:Prdm10	UTSW	9	31353425	missense	probably damaging	1.00
RF004:Prdm10	UTSW	9	31359126	missense	probably damaging	1.00
X0064:Prdm10	UTSW	9	31362451	missense	probably damaging	1.00
Z1176:Prdm10	UTSW	9	31316168	missense	possibly damaging	0.95
Z1176:Prdm10	UTSW	9	31316293	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTGAACTGCAGGCGTCAC -3'
(R):5'- GACACTCACCTGGATAAAATCTGG -3'

Sequencing Primer
(F):5'- GTGTCTTTCAGAATGCAGCTC -3'
(R):5'- GGAACCGTTTCTTACAAGTTGGGC -3'

Posted On

2020-07-13