Mutagenetix > Incidental Mutations

Incidental Mutation 'R8168:Raph1'

633887

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R8168 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60499620 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 389 (C389R)

Ref Sequence

ENSEMBL: ENSMUSP00000121023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027168
AA Change: C441R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: C441R

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090293
AA Change: C441R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: C441R

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: C389R

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: C389R

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182085

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,982,944	A150T	probably benign	Het
9430020K01Rik	A	T	18: 4,675,094	D952V	probably benign	Het
AI607873	A	C	1: 173,729,938	S411R	probably benign	Het
Ano4	A	G	10: 88,980,995	I652T	probably damaging	Het
Arhgef1	A	G	7: 24,925,406	T862A	probably benign	Het
Atp6v1b2	T	C	8: 69,108,331	S404P	possibly damaging	Het
Cfap54	A	T	10: 92,908,877	S2170T	unknown	Het
Copa	A	T	1: 172,099,672	H204L	probably damaging	Het
Cwc22	A	C	2: 77,927,271	V171G	probably damaging	Het
D230025D16Rik	C	T	8: 105,248,769	P330L	probably benign	Het
Dock5	A	T	14: 67,770,197		probably null	Het
Flrt1	G	A	19: 7,096,637	L182F	probably damaging	Het
Foxf1	T	C	8: 121,085,162	V255A	probably damaging	Het
Gnptab	G	T	10: 88,419,133	A194S	probably benign	Het
Gzf1	C	T	2: 148,684,766	R386C	probably damaging	Het
H2-Aa	T	A	17: 34,287,721	T16S	possibly damaging	Het
Hdgfrp2	T	C	17: 56,082,282	F52S	probably damaging	Het
Htt	A	G	5: 34,882,956	N2154S	probably benign	Het
Lama3	T	A	18: 12,506,942	W65R	probably null	Het
Mef2c	G	T	13: 83,656,350	L356F	probably damaging	Het
Mrgprb2	A	T	7: 48,552,019	S319R	probably benign	Het
Mtrr	C	T	13: 68,572,613	V288I	probably benign	Het
Myo18a	T	A	11: 77,821,142	I713N	probably damaging	Het
Nelfa	A	T	5: 33,921,907	N107K	possibly damaging	Het
Nim1k	A	T	13: 119,712,752	V202D	probably damaging	Het
Nlrc4	T	C	17: 74,445,211	T726A	probably benign	Het
Olfr1154	T	A	2: 87,903,199	H159L	probably damaging	Het
Olfr1208	T	A	2: 88,896,776	M274L	probably benign	Het
Prdm10	G	A	9: 31,346,967	A514T	probably benign	Het
Prg4	T	A	1: 150,455,850	E357D	unknown	Het
Ptp4a3	T	G	15: 73,756,846	Y152D	probably damaging	Het
Rcc1	T	C	4: 132,335,785	E170G	probably benign	Het
Spag17	C	T	3: 100,034,984	T775M	possibly damaging	Het
Srcap	T	A	7: 127,542,523	V1825D	probably damaging	Het
Tex40	A	G	19: 6,922,652	S162P	possibly damaging	Het
Tshr	T	A	12: 91,511,965	H195Q	probably benign	Het
Vmn1r174	A	T	7: 23,754,671	D254V	probably damaging	Het
Vps13a	A	C	19: 16,749,548	I244M	probably benign	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAAACCATCTTCCGTGTGTC -3'
(R):5'- ACACTCCAGGATTGCCACAG -3'

Sequencing Primer
(F):5'- ATCTTCCGTGTGTCTTAATACAGG -3'
(R):5'- TCCAGGATTGCCACAGTAATTC -3'

Posted On

2020-07-13