Incidental Mutation 'R8168:Raph1'
ID 633887
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin
MMRRC Submission 067594-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R8168 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 60482292-60567104 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60499620 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 389 (C389R)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably damaging
Transcript: ENSMUST00000027168
AA Change: C441R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: C441R

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090293
AA Change: C441R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: C441R

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: C389R
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: C389R

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,982,944 A150T probably benign Het
Ano4 A G 10: 88,980,995 I652T probably damaging Het
Arhgef1 A G 7: 24,925,406 T862A probably benign Het
Atp6v1b2 T C 8: 69,108,331 S404P possibly damaging Het
Catsperz A G 19: 6,922,652 S162P possibly damaging Het
Cfap54 A T 10: 92,908,877 S2170T unknown Het
Copa A T 1: 172,099,672 H204L probably damaging Het
Cwc22 A C 2: 77,927,271 V171G probably damaging Het
D230025D16Rik C T 8: 105,248,769 P330L probably benign Het
Dock5 A T 14: 67,770,197 probably null Het
Flrt1 G A 19: 7,096,637 L182F probably damaging Het
Foxf1 T C 8: 121,085,162 V255A probably damaging Het
Gnptab G T 10: 88,419,133 A194S probably benign Het
Gzf1 C T 2: 148,684,766 R386C probably damaging Het
H2-Aa T A 17: 34,287,721 T16S possibly damaging Het
Hdgfl2 T C 17: 56,082,282 F52S probably damaging Het
Htt A G 5: 34,882,956 N2154S probably benign Het
Ifi207 A C 1: 173,729,938 S411R probably benign Het
Jcad A T 18: 4,675,094 D952V probably benign Het
Lama3 T A 18: 12,506,942 W65R probably null Het
Mef2c G T 13: 83,656,350 L356F probably damaging Het
Mrgprb2 A T 7: 48,552,019 S319R probably benign Het
Mtrr C T 13: 68,572,613 V288I probably benign Het
Myo18a T A 11: 77,821,142 I713N probably damaging Het
Nelfa A T 5: 33,921,907 N107K possibly damaging Het
Nim1k A T 13: 119,712,752 V202D probably damaging Het
Nlrc4 T C 17: 74,445,211 T726A probably benign Het
Olfr1154 T A 2: 87,903,199 H159L probably damaging Het
Olfr1208 T A 2: 88,896,776 M274L probably benign Het
Prdm10 G A 9: 31,346,967 A514T probably benign Het
Prg4 T A 1: 150,455,850 E357D unknown Het
Ptp4a3 T G 15: 73,756,846 Y152D probably damaging Het
Rcc1 T C 4: 132,335,785 E170G probably benign Het
Spag17 C T 3: 100,034,984 T775M possibly damaging Het
Srcap T A 7: 127,542,523 V1825D probably damaging Het
Tshr T A 12: 91,511,965 H195Q probably benign Het
Vmn1r174 A T 7: 23,754,671 D254V probably damaging Het
Vps13a A C 19: 16,749,548 I244M probably benign Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60525947 missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60502863 missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60489267 intron probably benign
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0227:Raph1 UTSW 1 60525977 missense probably benign 0.00
R0387:Raph1 UTSW 1 60510496 intron probably benign
R0607:Raph1 UTSW 1 60525869 missense probably damaging 1.00
R1740:Raph1 UTSW 1 60519024 nonsense probably null
R2274:Raph1 UTSW 1 60498500 missense probably damaging 1.00
R3108:Raph1 UTSW 1 60493386 missense probably benign 0.01
R3977:Raph1 UTSW 1 60498523 missense probably benign 0.39
R4260:Raph1 UTSW 1 60502965 missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60502869 missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60503001 unclassified probably benign
R4782:Raph1 UTSW 1 60489114 missense probably damaging 1.00
R5027:Raph1 UTSW 1 60496277 missense probably damaging 1.00
R5037:Raph1 UTSW 1 60496222 splice site probably null
R5106:Raph1 UTSW 1 60533300 missense probably damaging 1.00
R5506:Raph1 UTSW 1 60493498 intron probably benign
R5510:Raph1 UTSW 1 60522946 unclassified probably benign
R5587:Raph1 UTSW 1 60498473 missense probably damaging 1.00
R5591:Raph1 UTSW 1 60501746 unclassified probably benign
R5619:Raph1 UTSW 1 60490255 intron probably benign
R5776:Raph1 UTSW 1 60490156 intron probably benign
R5802:Raph1 UTSW 1 60488673 missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60525720 missense probably damaging 0.97
R7122:Raph1 UTSW 1 60525977 missense probably benign 0.10
R7219:Raph1 UTSW 1 60502873 missense unknown
R7251:Raph1 UTSW 1 60489868 missense unknown
R7254:Raph1 UTSW 1 60499608 missense unknown
R7732:Raph1 UTSW 1 60533288 missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60525989 missense probably benign 0.00
R7986:Raph1 UTSW 1 60496286 missense
R8167:Raph1 UTSW 1 60490111 missense unknown
R8399:Raph1 UTSW 1 60489318 missense unknown
R9036:Raph1 UTSW 1 60502965 missense unknown
R9146:Raph1 UTSW 1 60518978 critical splice donor site probably null
R9338:Raph1 UTSW 1 60490141 missense unknown
R9381:Raph1 UTSW 1 60501800 missense unknown
R9383:Raph1 UTSW 1 60525670 missense unknown
R9399:Raph1 UTSW 1 60525995 missense probably benign
R9454:Raph1 UTSW 1 60489594 missense unknown
R9561:Raph1 UTSW 1 60525728 missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60489267 intron probably benign
RF022:Raph1 UTSW 1 60489267 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACCATCTTCCGTGTGTC -3'
(R):5'- ACACTCCAGGATTGCCACAG -3'

Sequencing Primer
(F):5'- ATCTTCCGTGTGTCTTAATACAGG -3'
(R):5'- TCCAGGATTGCCACAGTAATTC -3'
Posted On 2020-07-13