Incidental Mutation 'R0697:Cyp2g1'
ID63894
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Namecytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
MMRRC Submission 038881-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0697 (G1)
Quality Score118
Status Not validated
Chromosome7
Chromosomal Location26808892-26821205 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 26814727 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 253 (K253*)
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
Predicted Effect probably null
Transcript: ENSMUST00000040944
AA Change: K253*
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685
AA Change: K253*

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205273
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Aig1 T C 10: 13,829,325 N72S probably benign Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cpsf2 A G 12: 101,983,184 H53R probably benign Het
Crh C A 3: 19,694,077 G134C probably damaging Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Sirt5 T C 13: 43,385,576 F274L probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Vmn1r84 A T 7: 12,362,763 M1K probably null Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26809831 missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26814259 missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26814294 splice site probably benign
IGL02338:Cyp2g1 APN 7 26814804 splice site probably benign
IGL02452:Cyp2g1 APN 7 26811446 missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26819187 missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26809776 missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26819403 missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26814194 missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26814295 splice site probably benign
R0830:Cyp2g1 UTSW 7 26814791 missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26809682 critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26819433 missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26820710 missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26814154 missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26820801 missense probably benign 0.06
R5574:Cyp2g1 UTSW 7 26820740 missense possibly damaging 0.81
R5877:Cyp2g1 UTSW 7 26816640 missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26814179 missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26820759 missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26814632 missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26819193 missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26819461 missense probably benign
R8177:Cyp2g1 UTSW 7 26819153 missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26814734 missense possibly damaging 0.89
X0067:Cyp2g1 UTSW 7 26820762 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAAACGCTTCGACTATCAGGACCAG -3'
(R):5'- ATGAAACAGTACTTTCCCTTGTCACCC -3'

Sequencing Primer
(F):5'- gccttgaactgctgatccc -3'
(R):5'- CCCACCCCCATAGTTGTAGATG -3'
Posted On2013-07-30