Incidental Mutation 'R7040:Cyp2g1'
ID546991
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Namecytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7040 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26808892-26821205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26820759 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 472 (D472A)
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
AlphaFold Q9WV19
Predicted Effect probably damaging
Transcript: ENSMUST00000040944
AA Change: D472A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685
AA Change: D472A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26809831 missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26814259 missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26814294 splice site probably benign
IGL02338:Cyp2g1 APN 7 26814804 splice site probably benign
IGL02452:Cyp2g1 APN 7 26811446 missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26819187 missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26809776 missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26819403 missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26814194 missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26814295 splice site probably benign
R0697:Cyp2g1 UTSW 7 26814727 nonsense probably null
R0830:Cyp2g1 UTSW 7 26814791 missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26809682 critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26819433 missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26820710 missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26814154 missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26820801 missense probably benign 0.06
R5574:Cyp2g1 UTSW 7 26820740 missense possibly damaging 0.81
R5877:Cyp2g1 UTSW 7 26816640 missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26814179 missense probably damaging 1.00
R7223:Cyp2g1 UTSW 7 26814632 missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26819193 missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26819461 missense probably benign
R8177:Cyp2g1 UTSW 7 26819153 missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26814734 missense possibly damaging 0.89
R9043:Cyp2g1 UTSW 7 26809831 missense probably benign 0.05
X0067:Cyp2g1 UTSW 7 26820762 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CGTGGGCTAAGATGCTGAATAATC -3'
(R):5'- TCTCAGAACAACAGTGAGAGTGAC -3'

Sequencing Primer
(F):5'- CTGAATAATCAGTCGAGGCTGC -3'
(R):5'- ACCTCTCTTCAAGGAGTATGGAG -3'
Posted On2019-05-13