Mutagenetix > Incidental Mutation

Incidental Mutation 'R8246:Shank3'

640775

Institutional Source

Beutler Lab

Gene Symbol

Shank3

Ensembl Gene

ENSMUSG00000022623

Gene Name

SH3 and multiple ankyrin repeat domains 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R8246 (G1)

Quality Score

152.008

Status

Validated

Chromosome

Chromosomal Location

89499623-89560261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89533346 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 49 (R49W)

Ref Sequence

ENSEMBL: ENSMUSP00000132229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000066545] [ENSMUST00000109309] [ENSMUST00000167173]

AlphaFold

Q4ACU6

Predicted Effect

probably benign
Transcript: ENSMUST00000039074

SMART Domains

Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623

Domain	Start	End	E-Value	Type
ANK	182	211	1.54e-1	SMART
ANK	215	245	3.36e2	SMART
ANK	249	278	2.47e0	SMART
ANK	282	311	3.71e-4	SMART
ANK	315	345	5.03e2	SMART
low complexity region	434	462	N/A	INTRINSIC
SH3	473	528	1.28e-14	SMART
PDZ	579	664	3.95e-13	SMART
low complexity region	672	684	N/A	INTRINSIC
low complexity region	813	843	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	905	923	N/A	INTRINSIC
low complexity region	1078	1092	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1173	1194	N/A	INTRINSIC
low complexity region	1235	1252	N/A	INTRINSIC
low complexity region	1266	1278	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1341	1355	N/A	INTRINSIC
low complexity region	1370	1395	N/A	INTRINSIC
low complexity region	1409	1427	N/A	INTRINSIC
low complexity region	1552	1558	N/A	INTRINSIC
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1626	1658	N/A	INTRINSIC
SAM	1664	1730	3.08e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066545

SMART Domains

Protein: ENSMUSP00000064477
Gene: ENSMUSG00000022623

Domain	Start	End	E-Value	Type
ANK	109	138	1.54e-1	SMART
ANK	142	172	3.36e2	SMART
ANK	176	205	2.47e0	SMART
ANK	209	238	3.71e-4	SMART
ANK	242	272	5.03e2	SMART
low complexity region	361	389	N/A	INTRINSIC
SH3	400	455	1.28e-14	SMART
PDZ	506	591	3.95e-13	SMART
low complexity region	599	611	N/A	INTRINSIC
low complexity region	625	636	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109309

SMART Domains

Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623

Domain	Start	End	E-Value	Type
low complexity region	5	55	N/A	INTRINSIC
Pfam:FERM_f0	84	167	2.5e-14	PFAM
ANK	257	286	1.54e-1	SMART
ANK	290	320	3.36e2	SMART
ANK	324	353	2.47e0	SMART
ANK	357	386	3.71e-4	SMART
ANK	390	420	5.03e2	SMART
low complexity region	509	537	N/A	INTRINSIC
SH3	548	603	1.28e-14	SMART
PDZ	654	739	3.95e-13	SMART
low complexity region	747	759	N/A	INTRINSIC
low complexity region	888	918	N/A	INTRINSIC
low complexity region	932	944	N/A	INTRINSIC
low complexity region	980	998	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC
low complexity region	1184	1196	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1310	1327	N/A	INTRINSIC
low complexity region	1341	1353	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1416	1430	N/A	INTRINSIC
low complexity region	1445	1470	N/A	INTRINSIC
low complexity region	1484	1502	N/A	INTRINSIC
low complexity region	1627	1633	N/A	INTRINSIC
low complexity region	1659	1674	N/A	INTRINSIC
low complexity region	1701	1733	N/A	INTRINSIC
SAM	1739	1805	3.08e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167173
AA Change: R49W

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132229
Gene: ENSMUSG00000022623
AA Change: R49W

Domain	Start	End	E-Value	Type
low complexity region	57	66	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	C	5: 9,446,966	V810A	probably benign	Het
Alpk3	C	A	7: 81,092,776	D780E	probably benign	Het
Anln	A	C	9: 22,350,955	S947A	probably benign	Het
Borcs6	C	T	11: 69,060,551	P252S	probably benign	Het
Ccdc109b	C	A	3: 129,915,165	V328L	probably benign	Het
Ccdc42	C	A	11: 68,587,296	Q28K	probably benign	Het
Cp	A	G	3: 19,975,022	I554M	probably damaging	Het
Dnm3	T	G	1: 162,307,917	D429A	probably damaging	Het
Dok5	A	G	2: 170,800,893	K37R	probably benign	Het
Dtwd2	A	T	18: 49,698,425	Y268N	probably benign	Het
Eif3a	T	C	19: 60,779,368	E244G	probably damaging	Het
Fam149a	T	C	8: 45,381,618	E48G	probably benign	Het
Fam160a2	T	C	7: 105,389,660	E124G	probably damaging	Het
Fam186a	T	A	15: 99,940,547	E2605D	unknown	Het
Fyn	T	A	10: 39,529,529	W264R	probably damaging	Het
Gm10024	T	A	10: 77,711,535	S27T	unknown	Het
Gm156	A	G	6: 129,775,376		probably benign	Het
Gpr157	C	T	4: 150,102,296	L294F	possibly damaging	Het
Kif6	C	T	17: 49,758,514	Q506*	probably null	Het
Loxhd1	A	G	18: 77,363,546	K707R	possibly damaging	Het
Mdn1	C	T	4: 32,657,284	P12S	probably benign	Het
Mrgprb3	T	G	7: 48,643,520	L94F	probably benign	Het
Mycbp2	G	T	14: 103,155,204	P3307Q	probably damaging	Het
Nol8	T	G	13: 49,655,248		probably benign	Het
Olfr1308	T	C	2: 111,960,138	I312V	probably benign	Het
Olfr744	A	G	14: 50,618,384	Y54C	probably benign	Het
Pax5	T	C	4: 44,570,027	H286R	probably benign	Het
Rmdn2	T	A	17: 79,672,537	C381*	probably null	Het
Rpusd4	A	G	9: 35,272,580	I202V	probably benign	Het
Smurf2	T	C	11: 106,831,044	T542A	probably benign	Het
Sorcs2	G	A	5: 36,062,588	R371C	probably damaging	Het
Sqstm1	T	C	11: 50,210,561	H66R	probably damaging	Het
Stard8	C	T	X: 99,065,964	S155L	probably benign	Het
Svep1	A	T	4: 58,091,889	V1582D	probably damaging	Het
Tecrl	T	C	5: 83,279,309	M331V	probably damaging	Het
Tinf2	T	C	14: 55,679,585	S368G	probably damaging	Het
Tmem184c	A	T	8: 77,610,185	I14N	probably damaging	Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Ulk4	T	C	9: 121,156,875	*911W	probably null	Het
Unc13b	T	C	4: 43,175,954	F2261L	unknown	Het
Vps16	G	C	2: 130,438,873	G241R	probably damaging	Het
Ythdc1	C	T	5: 86,817,322	T292I	possibly damaging	Het

Other mutations in Shank3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Shank3	APN	15	89549416	missense	probably damaging	1.00
IGL01469:Shank3	APN	15	89521274	missense	probably damaging	1.00
IGL01886:Shank3	APN	15	89531663	missense	probably damaging	1.00
IGL01934:Shank3	APN	15	89549846	missense	probably damaging	1.00
IGL01989:Shank3	APN	15	89503299	splice site	probably benign
IGL02004:Shank3	APN	15	89503299	splice site	probably benign
IGL02085:Shank3	APN	15	89503915	critical splice donor site	probably null
IGL02195:Shank3	APN	15	89548118	missense	probably damaging	1.00
IGL02354:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02361:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02541:Shank3	APN	15	89501410	missense	probably damaging	1.00
G1citation:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R0294:Shank3	UTSW	15	89532098	missense	probably damaging	1.00
R0468:Shank3	UTSW	15	89549275	missense	probably benign	0.28
R0483:Shank3	UTSW	15	89543239	splice site	probably benign
R0605:Shank3	UTSW	15	89524147	missense	possibly damaging	0.49
R0675:Shank3	UTSW	15	89531388	missense	possibly damaging	0.92
R1082:Shank3	UTSW	15	89549371	missense	probably damaging	1.00
R1576:Shank3	UTSW	15	89503663	missense	probably benign	0.11
R1702:Shank3	UTSW	15	89499896	missense	probably damaging	0.99
R1726:Shank3	UTSW	15	89557986	missense	probably damaging	1.00
R1958:Shank3	UTSW	15	89503148	missense	probably damaging	0.99
R1961:Shank3	UTSW	15	89557964	missense	possibly damaging	0.60
R2420:Shank3	UTSW	15	89521210	nonsense	probably null
R2513:Shank3	UTSW	15	89548686	missense	probably benign	0.05
R3917:Shank3	UTSW	15	89503384	missense	possibly damaging	0.77
R4163:Shank3	UTSW	15	89549594	missense	probably damaging	1.00
R4205:Shank3	UTSW	15	89503318	missense	probably damaging	1.00
R4434:Shank3	UTSW	15	89503359	missense	probably damaging	1.00
R4791:Shank3	UTSW	15	89500354	missense	probably damaging	1.00
R4816:Shank3	UTSW	15	89543115	missense	probably damaging	1.00
R4828:Shank3	UTSW	15	89500199	intron	probably benign
R4911:Shank3	UTSW	15	89504344	missense	probably damaging	1.00
R4997:Shank3	UTSW	15	89549698	missense	probably damaging	1.00
R5213:Shank3	UTSW	15	89533278	missense	possibly damaging	0.82
R5338:Shank3	UTSW	15	89531711	splice site	probably null
R5494:Shank3	UTSW	15	89548238	missense	probably damaging	0.99
R5543:Shank3	UTSW	15	89532354	missense	probably damaging	1.00
R5654:Shank3	UTSW	15	89521326	missense	probably benign	0.07
R5900:Shank3	UTSW	15	89503390	missense	probably damaging	1.00
R5906:Shank3	UTSW	15	89548916	missense	probably damaging	1.00
R6385:Shank3	UTSW	15	89521375	critical splice donor site	probably null
R6432:Shank3	UTSW	15	89503413	missense	possibly damaging	0.75
R6724:Shank3	UTSW	15	89532453	missense	probably damaging	1.00
R6822:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R6845:Shank3	UTSW	15	89548325	missense	probably benign	0.00
R7088:Shank3	UTSW	15	89503525	splice site	probably null
R7390:Shank3	UTSW	15	89549312	missense	probably benign	0.05
R7808:Shank3	UTSW	15	89548880	missense	probably damaging	1.00
R7862:Shank3	UTSW	15	89505445	missense	possibly damaging	0.73
R8039:Shank3	UTSW	15	89505439	missense	probably damaging	1.00
R8090:Shank3	UTSW	15	89505458	critical splice donor site	probably null
R8170:Shank3	UTSW	15	89548840	missense	possibly damaging	0.69
R8189:Shank3	UTSW	15	89549236	missense	probably benign
R8515:Shank3	UTSW	15	89503572	nonsense	probably null
R8525:Shank3	UTSW	15	89547770	missense	probably damaging	0.99
R8537:Shank3	UTSW	15	89532215	missense	probably damaging	1.00
R8673:Shank3	UTSW	15	89549776	missense	probably damaging	1.00
R8826:Shank3	UTSW	15	89549395	missense	probably damaging	1.00
R8932:Shank3	UTSW	15	89548783	missense	possibly damaging	0.86
R8954:Shank3	UTSW	15	89549228	missense	possibly damaging	0.88
R8976:Shank3	UTSW	15	89558178	missense	probably damaging	1.00
R8992:Shank3	UTSW	15	89548685	missense	possibly damaging	0.95
R8994:Shank3	UTSW	15	89533213	missense	probably benign	0.27
R9130:Shank3	UTSW	15	89558216	missense	probably benign	0.19
R9258:Shank3	UTSW	15	89504318	missense	probably damaging	1.00
R9645:Shank3	UTSW	15	89525250	missense	possibly damaging	0.96
RF020:Shank3	UTSW	15	89500390	missense	probably benign	0.20
Z1177:Shank3	UTSW	15	89558322	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- CATTTGAGGCCTTGGTCCTG -3'
(R):5'- ACTGCCGATCTGTCTCCAAAC -3'

Sequencing Primer
(F):5'- TCCTGGGAGTCTGAAGAGC -3'
(R):5'- TGAGCCCCCAGTTCAGTC -3'

Posted On

2020-07-28