Incidental Mutation 'R8328:Olfr311'
ID644210
Institutional Source Beutler Lab
Gene Symbol Olfr311
Ensembl Gene ENSMUSG00000094805
Gene Nameolfactory receptor 311
SynonymsMOR222-1, GA_x6K02T2NKPP-565870-564944
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58839251-58844111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58841634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 173 (D173E)
Ref Sequence ENSEMBL: ENSMUSP00000150870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071625] [ENSMUST00000216473]
Predicted Effect probably benign
Transcript: ENSMUST00000071625
AA Change: D173E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071553
Gene: ENSMUSG00000094805
AA Change: D173E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 9e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 215 1.7e-8 PFAM
Pfam:7tm_1 39 288 9.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216473
AA Change: D173E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Olfr311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Olfr311 APN 11 58841512 missense probably benign 0.10
H8786:Olfr311 UTSW 11 58841320 missense probably benign 0.22
R0620:Olfr311 UTSW 11 58841443 missense probably damaging 1.00
R0671:Olfr311 UTSW 11 58841855 missense possibly damaging 0.94
R0827:Olfr311 UTSW 11 58841771 missense probably damaging 1.00
R0839:Olfr311 UTSW 11 58841652 missense probably benign
R0932:Olfr311 UTSW 11 58841714 missense possibly damaging 0.92
R1117:Olfr311 UTSW 11 58841815 missense possibly damaging 0.64
R1533:Olfr311 UTSW 11 58841966 missense probably damaging 1.00
R1540:Olfr311 UTSW 11 58841651 missense probably benign 0.01
R1595:Olfr311 UTSW 11 58841652 missense probably benign
R1826:Olfr311 UTSW 11 58841431 missense probably benign
R2857:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2858:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2859:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R3438:Olfr311 UTSW 11 58841872 nonsense probably null
R3765:Olfr311 UTSW 11 58841294 missense probably damaging 1.00
R3831:Olfr311 UTSW 11 58841860 missense probably damaging 0.99
R4858:Olfr311 UTSW 11 58841207 missense possibly damaging 0.86
R5651:Olfr311 UTSW 11 58841491 nonsense probably null
R5979:Olfr311 UTSW 11 58841840 missense probably damaging 1.00
R6316:Olfr311 UTSW 11 58841942 missense probably damaging 1.00
R6717:Olfr311 UTSW 11 58841287 missense probably damaging 1.00
R7163:Olfr311 UTSW 11 58841186 missense probably benign 0.12
R7605:Olfr311 UTSW 11 58841500 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACTGAATGCTTTCTGCTCACG -3'
(R):5'- GAGCAGGTAGAAAAGGCTTTCC -3'

Sequencing Primer
(F):5'- TCACGGCCATGGCTTATGAC -3'
(R):5'- GTAGAAAAGGCTTTCCACCTGC -3'
Posted On2020-09-02