Incidental Mutation 'R8328:Cyp2j11'
ID644192
Institutional Source Beutler Lab
Gene Symbol Cyp2j11
Ensembl Gene ENSMUSG00000066097
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 11
SynonymsCyp2j11-ps
MMRRC Submission
Accession Numbers

Genbank: NM_001004141; MGI: 2140224

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location96294508-96348662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96348368 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 67 (H67L)
Ref Sequence ENSEMBL: ENSMUSP00000132180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015368]
Predicted Effect probably benign
Transcript: ENSMUST00000015368
AA Change: H67L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132180
Gene: ENSMUSG00000066097
AA Change: H67L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 500 4.3e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Cyp2j11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Cyp2j11 APN 4 96339095 missense probably benign
IGL01816:Cyp2j11 APN 4 96294924 missense probably damaging 1.00
IGL02406:Cyp2j11 APN 4 96348539 missense possibly damaging 0.56
E7848:Cyp2j11 UTSW 4 96319365 missense probably benign 0.09
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R1298:Cyp2j11 UTSW 4 96307260 critical splice donor site probably null
R1411:Cyp2j11 UTSW 4 96345216 missense probably benign 0.03
R1428:Cyp2j11 UTSW 4 96294880 missense probably benign 0.01
R1740:Cyp2j11 UTSW 4 96319376 missense probably benign 0.00
R1818:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1819:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1917:Cyp2j11 UTSW 4 96339974 missense probably damaging 1.00
R2084:Cyp2j11 UTSW 4 96339201 missense probably damaging 1.00
R2146:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2148:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2150:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R4963:Cyp2j11 UTSW 4 96316382 missense probably damaging 1.00
R5335:Cyp2j11 UTSW 4 96307352 missense probably damaging 1.00
R5450:Cyp2j11 UTSW 4 96339876 missense probably benign 0.44
R5688:Cyp2j11 UTSW 4 96345121 missense probably damaging 1.00
R5978:Cyp2j11 UTSW 4 96319352 missense probably damaging 1.00
R6061:Cyp2j11 UTSW 4 96348616 start gained probably benign
R6075:Cyp2j11 UTSW 4 96345085 missense probably benign 0.04
R6912:Cyp2j11 UTSW 4 96294871 missense probably benign 0.00
R7338:Cyp2j11 UTSW 4 96307287 missense possibly damaging 0.64
R7394:Cyp2j11 UTSW 4 96316440 missense probably benign 0.00
R7464:Cyp2j11 UTSW 4 96345120 missense probably damaging 1.00
R7972:Cyp2j11 UTSW 4 96297634 missense probably damaging 1.00
R8152:Cyp2j11 UTSW 4 96307292 missense probably damaging 1.00
R8383:Cyp2j11 UTSW 4 96348458 missense probably benign 0.00
Z1176:Cyp2j11 UTSW 4 96307303 missense probably damaging 0.99
Z1176:Cyp2j11 UTSW 4 96307436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATGGGCACTTGCTTACACATTTG -3'
(R):5'- GGCTAACATCTGCTCAGCAATC -3'

Sequencing Primer
(F):5'- GCACTTGCTTACACATTTGTTATAGC -3'
(R):5'- GCTCAGCAATCCATCTCTGG -3'
Posted On2020-09-02