Incidental Mutation 'R8328:Slc9c1'
ID644220
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45577864 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 664 (I664K)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: I664K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I664K

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGCTCCAGTTAAGTAGGAATAG -3'
(R):5'- GGTATGTCTGAAGAAAGTGTGC -3'

Sequencing Primer
(F):5'- GCTCCAGTTAAGTAGGAATAGAATTG -3'
(R):5'- TGTCTGAAGAAAGTGTGCTTTAC -3'
Posted On2020-09-02