Incidental Mutation 'R8500:Blm'
ID658470
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8500 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80455284 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1412 (L1412P)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably damaging
Transcript: ENSMUST00000081314
AA Change: L1409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: L1409P

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170315
AA Change: L1412P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: L1412P

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000206989
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,987,635 S56N probably benign Het
Atg16l2 T G 7: 101,290,266 D542A probably damaging Het
Cdc37 T C 9: 21,140,801 D314G probably damaging Het
Cela1 T A 15: 100,675,332 M39L probably benign Het
Col12a1 T A 9: 79,609,851 D2849V probably damaging Het
Fam53c A G 18: 34,768,801 E257G probably damaging Het
Fmo9 A T 1: 166,674,470 N144K probably damaging Het
Gabrd T A 4: 155,385,691 M354L probably benign Het
Gm5773 A T 3: 93,773,528 D169V probably benign Het
Gria2 A T 3: 80,692,467 F703L probably damaging Het
Grm3 A T 5: 9,511,726 I708N probably benign Het
Hlcs G A 16: 94,262,758 P481L possibly damaging Het
Ifi206 T C 1: 173,486,745 Y43C Het
Igf2r A G 17: 12,709,441 L1005P probably damaging Het
Ighv2-6-8 T C 12: 113,796,214 N92D possibly damaging Het
Invs A G 4: 48,422,109 K914E probably damaging Het
Iqsec3 T C 6: 121,412,854 probably benign Het
Klra6 T C 6: 130,022,697 T103A probably benign Het
Lipo5 C T 19: 33,464,449 probably null Het
Llgl1 T C 11: 60,704,983 probably null Het
Lonrf1 T C 8: 36,231,138 E402G probably benign Het
Lrp1b T A 2: 41,506,779 Y311F probably benign Het
Lrrc8a T A 2: 30,256,196 W341R possibly damaging Het
Lrriq1 A G 10: 103,046,155 I117T Het
Mmp9 T C 2: 164,953,566 V668A possibly damaging Het
Naip5 A C 13: 100,222,712 M672R probably damaging Het
Ncam1 A T 9: 49,520,145 L664Q probably damaging Het
Nol4l T C 2: 153,436,346 D234G probably damaging Het
Olfr1101 T C 2: 86,988,478 K233E probably damaging Het
Oscp1 T A 4: 126,077,410 H170Q possibly damaging Het
Pard3 T A 8: 127,460,303 M1021K probably damaging Het
Pkd1l2 T A 8: 117,047,563 probably null Het
Plcxd2 T C 16: 45,980,586 K92E probably damaging Het
Pqlc2 A G 4: 139,300,129 probably benign Het
Ptpdc1 A T 13: 48,586,283 C557* probably null Het
Robo2 G A 16: 73,948,340 T849I probably damaging Het
Rp1 A T 1: 4,346,590 I1433N possibly damaging Het
Scarb1 A G 5: 125,294,163 S282P probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Sf3a1 T A 11: 4,175,039 S357T probably benign Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc1a3 T C 15: 8,642,369 T368A probably damaging Het
Taf11 A T 17: 27,902,620 I138N probably damaging Het
Tnfaip8l1 C T 17: 56,171,749 A13V probably damaging Het
Trav6-2 T G 14: 52,667,635 F38V probably benign Het
Vmn2r73 A G 7: 85,870,430 V440A probably benign Het
Zfp292 A G 4: 34,826,691 probably null Het
Zfp429 A T 13: 67,390,709 C205* probably null Het
Zfp735 C G 11: 73,710,985 L252V possibly damaging Het
Zfyve26 A T 12: 79,287,680 L188Q probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
R8543:Blm UTSW 7 80494216 missense probably damaging 0.98
R8749:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512910 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512907 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512918 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512919 small insertion probably benign
R8775-TAIL:Blm UTSW 7 80512931 small insertion probably benign
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCCACTACATGTGCAGTAG -3'
(R):5'- TCTCCTGGCAAGTTAACAGACAAG -3'

Sequencing Primer
(F):5'- TGCTGTAACAAGACTAACAG -3'
(R):5'- ACAGACAAGATTATTAACTTCGTCTC -3'
Posted On2021-01-18