Incidental Mutation 'R8786:Ptprb'
ID670645
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8786 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116319401 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 400 (T400P)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: T400P

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: T400P

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218553
AA Change: T687P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C A 2: 118,757,251 S534I unknown Het
Adamtsl4 A T 3: 95,685,474 M1K probably null Het
Atg2a G T 19: 6,244,430 V59L probably damaging Het
Atxn7 C A 14: 14,103,316 T888K possibly damaging Het
BC055324 A T 1: 163,964,471 L626Q probably damaging Het
Btbd9 T C 17: 30,530,170 R57G probably damaging Het
Crp T C 1: 172,698,726 V126A probably benign Het
Csf1r A T 18: 61,114,870 T337S probably damaging Het
Dcaf12 T C 4: 41,296,439 N299S probably damaging Het
Dcaf17 T C 2: 71,087,400 probably null Het
Dip2c A G 13: 9,615,794 D985G probably damaging Het
Dtna A G 18: 23,583,133 T138A probably benign Het
Emid1 T C 11: 5,131,517 D212G probably benign Het
Epyc G A 10: 97,675,663 D173N probably damaging Het
Fanci A G 7: 79,402,550 D162G probably benign Het
Fry T C 5: 150,394,036 V827A probably benign Het
Ggps1 T C 13: 14,053,920 E226G probably benign Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gopc G A 10: 52,354,654 R183* probably null Het
Grik4 C T 9: 42,541,834 G752S probably damaging Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
H2-Q1 T A 17: 35,320,893 V46D probably damaging Het
Hsd17b3 T C 13: 64,072,048 N126S probably damaging Het
Igsf10 G A 3: 59,330,642 T706I probably benign Het
Kmt2e A G 5: 23,464,866 D117G probably damaging Het
Krtap29-1 C T 11: 99,978,639 G139R probably damaging Het
Lama5 T C 2: 180,196,307 Y872C probably damaging Het
Lrriq4 T A 3: 30,650,603 M260K probably benign Het
Map2 G A 1: 66,433,596 probably benign Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mrpl51 C T 6: 125,192,377 A8V probably benign Het
Ndufs3 T C 2: 90,902,434 T103A probably benign Het
Numa1 T G 7: 101,998,409 L449R probably benign Het
Olfr1513 C T 14: 52,349,564 A161T possibly damaging Het
Pan3 C T 5: 147,488,141 P295S possibly damaging Het
Pds5b T C 5: 150,780,669 S846P probably damaging Het
Phf2 A T 13: 48,813,743 M712K unknown Het
Phlda2 A T 7: 143,502,474 V6E probably benign Het
Pkdrej C A 15: 85,819,843 A631S probably benign Het
Plcd3 G T 11: 103,071,743 N627K probably damaging Het
Prpf6 T C 2: 181,620,622 I138T possibly damaging Het
Psd4 G A 2: 24,405,432 S866N probably benign Het
Rxfp1 T C 3: 79,663,370 probably null Het
Sbf2 A G 7: 110,464,586 probably null Het
Setd4 C T 16: 93,593,274 R89Q probably benign Het
Sgpp1 A G 12: 75,716,378 I343T probably benign Het
Sh2b2 T C 5: 136,231,804 D186G probably benign Het
Slc12a4 A T 8: 105,953,917 I191N probably damaging Het
Slc4a4 A T 5: 89,084,690 D251V probably benign Het
Slc6a5 A T 7: 49,912,095 D125V possibly damaging Het
Slf1 T A 13: 77,126,687 I16F possibly damaging Het
Sncaip T C 18: 52,898,262 V521A probably damaging Het
Stx19 T C 16: 62,822,412 L197P probably damaging Het
Sucla2 A G 14: 73,560,465 N39D probably benign Het
Sult1d1 T A 5: 87,564,716 T90S probably benign Het
Syna C T 5: 134,559,869 M75I probably benign Het
Tas2r138 A G 6: 40,612,677 S212P probably damaging Het
Tdrd3 T A 14: 87,472,201 C106* probably null Het
Tex43 T C 18: 56,594,496 F89L probably damaging Het
Tlk2 C T 11: 105,281,233 A743V unknown Het
Tlr3 T C 8: 45,398,249 D537G possibly damaging Het
Tmc1 A G 19: 20,826,589 Y375H probably damaging Het
Tsen54 T A 11: 115,820,672 M305K probably damaging Het
Umod C T 7: 119,477,358 V62M possibly damaging Het
Vmn1r10 A G 6: 57,114,025 T201A probably benign Het
Vmn1r103 T C 7: 20,509,751 T262A probably benign Het
Vmn2r100 T C 17: 19,522,576 V404A probably damaging Het
Vmn2r56 A G 7: 12,715,466 F282L probably damaging Het
Wdr64 A T 1: 175,808,761 K982* probably null Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
R7833:Ptprb UTSW 10 116315251 missense probably benign 0.01
R7834:Ptprb UTSW 10 116339424 missense probably benign 0.00
R7846:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7896:Ptprb UTSW 10 116369457 splice site probably null
R7901:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7912:Ptprb UTSW 10 116322487 missense probably damaging 1.00
R7941:Ptprb UTSW 10 116283677 small deletion probably benign
R8147:Ptprb UTSW 10 116317378 missense probably damaging 1.00
R8202:Ptprb UTSW 10 116353845 missense probably damaging 1.00
R8339:Ptprb UTSW 10 116283451 missense probably benign 0.14
R8400:Ptprb UTSW 10 116283572 small deletion probably benign
R8504:Ptprb UTSW 10 116341031 missense probably benign 0.27
R8679:Ptprb UTSW 10 116367590 missense probably damaging 1.00
R8914:Ptprb UTSW 10 116322662 nonsense probably null
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Z1176:Ptprb UTSW 10 116302156 frame shift probably null
Z1177:Ptprb UTSW 10 116362642 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTACTCAGAAATCAGGAGGC -3'
(R):5'- TTGACAGCGCTCGGAATTC -3'

Sequencing Primer
(F):5'- TCAGGAGGCAATACACATGTGATC -3'
(R):5'- GGAATTCCGCAGATTTCCGC -3'
Posted On2021-04-30