Mutagenetix > Incidental Mutations

Incidental Mutation 'R7103:Ptprb'

551000

Institutional Source

Beutler Lab

Gene Symbol

Ptprb

Ensembl Gene

ENSMUSG00000020154

Gene Name

protein tyrosine phosphatase, receptor type, B

Synonyms

3230402H02Rik, VE-PTP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116275523-116389535 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116338813 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 797 (Y797N)

Ref Sequence

ENSEMBL: ENSMUSP00000089805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092167
AA Change: Y797N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: Y797N

Domain	Start	End	E-Value	Type
FN3	22	102	8.23e1	SMART
FN3	111	193	1.73e-5	SMART
FN3	204	281	1.56e-3	SMART
FN3	290	366	6.45e-5	SMART
FN3	378	459	5e-2	SMART
FN3	468	546	1.61e-5	SMART
FN3	555	632	7.18e-3	SMART
FN3	644	724	7.52e-6	SMART
FN3	732	811	2.92e-3	SMART
FN3	820	899	2.76e-4	SMART
FN3	908	987	1.29e-4	SMART
FN3	996	1075	7.7e-3	SMART
FN3	1086	1166	1.21e0	SMART
FN3	1174	1253	5.08e-3	SMART
FN3	1262	1340	1.17e-7	SMART
FN3	1356	1435	2.68e-2	SMART
Blast:FN3	1450	1591	6e-88	BLAST
transmembrane domain	1620	1642	N/A	INTRINSIC
Blast:PTPc	1643	1681	3e-11	BLAST
PTPc	1703	1966	1.05e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218553
AA Change: Y1084N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Ptprb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Ptprb	APN	10	116362648	missense	probably benign	0.15
IGL01354:Ptprb	APN	10	116343891	missense	probably benign	0.24
IGL01404:Ptprb	APN	10	116339436	missense	probably benign	0.14
IGL01410:Ptprb	APN	10	116302274	missense	possibly damaging	0.60
IGL01412:Ptprb	APN	10	116343915	missense	probably benign	0.27
IGL01731:Ptprb	APN	10	116372876	missense	probably damaging	1.00
IGL02003:Ptprb	APN	10	116367505	missense	probably damaging	1.00
IGL02110:Ptprb	APN	10	116331203	splice site	probably benign
IGL02178:Ptprb	APN	10	116322532	missense	probably benign	0.00
IGL02304:Ptprb	APN	10	116331259	missense	probably damaging	1.00
IGL02324:Ptprb	APN	10	116319333	missense	probably benign	0.03
IGL02388:Ptprb	APN	10	116367521	missense	probably damaging	1.00
IGL02640:Ptprb	APN	10	116338664	missense	probably damaging	0.99
IGL02698:Ptprb	APN	10	116363280	missense	probably benign	0.05
IGL02876:Ptprb	APN	10	116348211	splice site	probably benign
IGL02879:Ptprb	APN	10	116327968	missense	probably benign
IGL02982:Ptprb	APN	10	116322628	missense	probably benign	0.20
IGL03146:Ptprb	APN	10	116328127	missense	probably benign	0.14
IGL03351:Ptprb	APN	10	116339582	missense	probably benign	0.03
R0306:Ptprb	UTSW	10	116343988	missense	probably benign	0.04
R0385:Ptprb	UTSW	10	116350178	missense	probably benign	0.00
R0600:Ptprb	UTSW	10	116368807	missense	possibly damaging	0.63
R0613:Ptprb	UTSW	10	116302325	missense	possibly damaging	0.59
R0613:Ptprb	UTSW	10	116302378	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116302125	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116339510	missense	probably damaging	1.00
R1331:Ptprb	UTSW	10	116367532	missense	probably damaging	1.00
R1413:Ptprb	UTSW	10	116339679	missense	probably damaging	1.00
R1418:Ptprb	UTSW	10	116319470	missense	probably benign	0.00
R1545:Ptprb	UTSW	10	116380869	missense	probably damaging	1.00
R1562:Ptprb	UTSW	10	116339467	missense	probably benign	0.00
R1752:Ptprb	UTSW	10	116340990	missense	probably benign	0.44
R1837:Ptprb	UTSW	10	116341626	missense	probably benign	0.00
R1940:Ptprb	UTSW	10	116319610	splice site	probably benign
R1958:Ptprb	UTSW	10	116341536	missense	probably benign	0.10
R2029:Ptprb	UTSW	10	116347053	missense	probably benign	0.37
R2031:Ptprb	UTSW	10	116317543	missense	probably benign
R2101:Ptprb	UTSW	10	116315038	splice site	probably benign
R2209:Ptprb	UTSW	10	116369357	missense	probably damaging	1.00
R3016:Ptprb	UTSW	10	116357295	missense	possibly damaging	0.64
R3076:Ptprb	UTSW	10	116344026	missense	probably damaging	0.99
R3821:Ptprb	UTSW	10	116350074	missense	probably benign	0.11
R3824:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3825:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3841:Ptprb	UTSW	10	116346982	missense	possibly damaging	0.79
R3953:Ptprb	UTSW	10	116341494	missense	probably benign	0.00
R4125:Ptprb	UTSW	10	116353849	missense	probably benign	0.12
R4227:Ptprb	UTSW	10	116302225	missense	possibly damaging	0.96
R4385:Ptprb	UTSW	10	116346867	missense	probably benign
R4731:Ptprb	UTSW	10	116319333	missense	probably benign	0.03
R5009:Ptprb	UTSW	10	116348127	missense	possibly damaging	0.61
R5104:Ptprb	UTSW	10	116322459	missense	probably benign	0.17
R5114:Ptprb	UTSW	10	116348183	missense	possibly damaging	0.59
R5145:Ptprb	UTSW	10	116343915	missense	probably benign	0.27
R5214:Ptprb	UTSW	10	116369324	missense	possibly damaging	0.75
R5382:Ptprb	UTSW	10	116353871	missense	probably damaging	1.00
R5553:Ptprb	UTSW	10	116350185	missense	probably damaging	1.00
R5585:Ptprb	UTSW	10	116380854	missense	probably damaging	0.98
R5586:Ptprb	UTSW	10	116353827	missense	probably damaging	1.00
R5808:Ptprb	UTSW	10	116339487	missense	probably benign	0.00
R5875:Ptprb	UTSW	10	116348166	missense	probably benign	0.00
R6051:Ptprb	UTSW	10	116341090	nonsense	probably null
R6383:Ptprb	UTSW	10	116347007	nonsense	probably null
R6511:Ptprb	UTSW	10	116346820	missense	probably damaging	1.00
R6817:Ptprb	UTSW	10	116283677	small deletion	probably benign
R6826:Ptprb	UTSW	10	116317372	missense	probably benign	0.26
R6958:Ptprb	UTSW	10	116277248	missense	probably benign	0.32
R7129:Ptprb	UTSW	10	116283677	small deletion	probably benign
R7181:Ptprb	UTSW	10	116368766	missense	probably damaging	1.00
R7215:Ptprb	UTSW	10	116338776	missense	possibly damaging	0.94
R7289:Ptprb	UTSW	10	116328165	missense	probably damaging	0.99
R7315:Ptprb	UTSW	10	116362379	missense	possibly damaging	0.83
R7319:Ptprb	UTSW	10	116341404	missense	probably benign	0.01
R7381:Ptprb	UTSW	10	116341133	missense	probably benign
R7412:Ptprb	UTSW	10	116341138	missense	probably benign
R7483:Ptprb	UTSW	10	116283429	missense	probably benign	0.01
R7495:Ptprb	UTSW	10	116341448	missense	probably benign	0.12
R7508:Ptprb	UTSW	10	116353991	nonsense	probably null
R7571:Ptprb	UTSW	10	116339430	missense	probably damaging	1.00
R7586:Ptprb	UTSW	10	116343874	missense	probably damaging	0.97
R7623:Ptprb	UTSW	10	116369309	missense	possibly damaging	0.63
R7694:Ptprb	UTSW	10	116372948	missense	probably damaging	1.00
R7744:Ptprb	UTSW	10	116277484	missense	probably benign	0.10
R7752:Ptprb	UTSW	10	116369428	missense	probably benign	0.37
R7826:Ptprb	UTSW	10	116283677	small deletion	probably benign
RF041:Ptprb	UTSW	10	116283677	small deletion	probably benign
X0020:Ptprb	UTSW	10	116302180	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TCCAGGGAATCAGTGTTAGCAAC -3'
(R):5'- TGCTTGGCTGAATGGGATAAGC -3'

Sequencing Primer
(F):5'- GGAATCAGTGTTAGCAACTCTGC -3'
(R):5'- CCAGGTGGGAGTTATTGGGATTATAG -3'

Posted On

2019-05-15