Incidental Mutation 'R7103:Ptprb'
ID551000
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116338813 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 797 (Y797N)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably damaging
Transcript: ENSMUST00000092167
AA Change: Y797N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: Y797N

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218553
AA Change: Y1084N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCCAGGGAATCAGTGTTAGCAAC -3'
(R):5'- TGCTTGGCTGAATGGGATAAGC -3'

Sequencing Primer
(F):5'- GGAATCAGTGTTAGCAACTCTGC -3'
(R):5'- CCAGGTGGGAGTTATTGGGATTATAG -3'
Posted On2019-05-15