Mutagenetix > Incidental Mutation

Incidental Mutation 'R9223:Thbs4'

699620

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

068959-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92761490 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 607 (C607Y)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably damaging
Transcript: ENSMUST00000022213
AA Change: C607Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: C607Y

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9630041A04Rik	C	A	9: 101,942,994	D204E	possibly damaging	Het
Aldh3a2	A	G	11: 61,265,211	S80P	probably benign	Het
Bcl6b	A	T	11: 70,226,574	Y407*	probably null	Het
Cel	TTA	TTATA	2: 28,559,429		probably null	Het
Cerkl	A	T	2: 79,341,330	C395S	probably damaging	Het
Chst5	C	A	8: 111,890,860	V43L	probably benign	Het
Clip1	A	T	5: 123,646,274	F271I	probably damaging	Het
Clspn	A	G	4: 126,590,618	T1190A	possibly damaging	Het
Col20a1	A	T	2: 181,006,735	E938D	probably damaging	Het
Ctgf	T	C	10: 24,595,958	V49A	probably benign	Het
Dmrta2	G	A	4: 109,982,582	V509M	probably damaging	Het
Dnah7b	T	A	1: 46,322,260	M3440K	probably benign	Het
Erlin1	A	G	19: 44,040,745		probably null	Het
Fam24b	A	G	7: 131,326,140	S107P	probably benign	Het
Fancm	T	A	12: 65,102,584	I708N	probably benign	Het
Fbxo11	A	T	17: 88,015,696	D12E		Het
Fbxw13	T	C	9: 109,195,048	D39G	probably damaging	Het
Gabrb3	T	G	7: 57,816,404	L322R	probably damaging	Het
Gm10696	A	C	3: 94,175,643	L287R	probably damaging	Het
Gm5239	A	T	18: 35,536,619	I13F	possibly damaging	Het
Heatr1	A	G	13: 12,404,921	Y375C	probably benign	Het
Helq	A	T	5: 100,798,437	S13T	possibly damaging	Het
Helz	A	G	11: 107,619,092	T514A	probably benign	Het
Hook3	A	G	8: 26,032,524	V32A		Het
Htra4	A	G	8: 25,037,032	I249T	possibly damaging	Het
Htt	G	T	5: 34,905,348	V2809L	probably benign	Het
Ifi203	T	A	1: 173,937,871	I46F	probably benign	Het
Kcna2	A	T	3: 107,104,990	I296F	possibly damaging	Het
Kndc1	A	G	7: 139,921,441	E882G	possibly damaging	Het
Krtap16-1	A	T	11: 99,985,245	D444E	probably benign	Het
Lrrtm3	ATTTT	ATTTTT	10: 64,089,256		probably null	Het
Mdga2	C	T	12: 66,568,860	D658N	possibly damaging	Het
Mkrn1	T	C	6: 39,401,249	K316R	possibly damaging	Het
Mmd2	C	T	5: 142,567,911	C165Y	probably damaging	Het
Mpdz	A	G	4: 81,284,630	F1843L	probably damaging	Het
Mrc2	G	A	11: 105,329,267	R338Q	probably damaging	Het
Naip5	C	T	13: 100,227,676	R372H	probably benign	Het
Nav2	C	A	7: 49,552,851	S1461Y	probably damaging	Het
Nol8	T	A	13: 49,661,262	V282D	possibly damaging	Het
Nup98	C	A	7: 102,184,960	G265V	possibly damaging	Het
Olfr1049	G	T	2: 86,255,200	F164L	possibly damaging	Het
Olfr1311	T	A	2: 112,021,172	K227N	possibly damaging	Het
Olfr1318	T	A	2: 112,156,128	M59K	possibly damaging	Het
Olfr132	C	T	17: 38,131,121	E24K	possibly damaging	Het
Olfr1532-ps1	A	G	7: 106,914,773	T192A	possibly damaging	Het
Olfr356	T	C	2: 36,937,899	F260S	probably damaging	Het
Otogl	T	A	10: 107,854,344	E888D	probably damaging	Het
Pcdhgc4	A	G	18: 37,815,632	I34V	possibly damaging	Het
Ppp1r12b	T	C	1: 134,879,638	R417G	probably benign	Het
Rtn4	A	G	11: 29,706,778	S311G	probably benign	Het
Serinc3	A	G	2: 163,636,892	V105A	probably benign	Het
Serpina3f	A	G	12: 104,217,185	D102G	possibly damaging	Het
Sik3	A	G	9: 46,155,474	I184V	probably damaging	Het
Tex35	A	T	1: 157,107,866	C21S	probably benign	Het
Tfap2b	T	C	1: 19,212,425		probably null	Het
Tmem144	A	T	3: 79,827,657	N151K	probably benign	Het
Tomm70a	T	A	16: 57,142,803	M395K	probably benign	Het
Trim43b	A	C	9: 89,085,610	H324Q	probably benign	Het
Vmn2r116	A	T	17: 23,401,167	Y625F	probably damaging	Het
Yipf3	A	T	17: 46,248,872	N38I	probably damaging	Het
Zfp804b	T	A	5: 6,771,496	E522D	probably benign	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTCCCCATCCTGATTCATC -3'
(R):5'- AGCAGCTGCAAGTCTCTGTTTC -3'

Sequencing Primer
(F):5'- GTCAGTAACTATCTCGACTGGAC -3'
(R):5'- AGCTGCAAGTCTCTGTTTCCTACC -3'

Posted On

2022-02-07