Mutagenetix > Incidental Mutation

Incidental Mutation 'R8022:Thbs4'

617480

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

067461-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 92752447 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 913 (T913P)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably damaging
Transcript: ENSMUST00000022213
AA Change: T913P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: T913P

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,223,854	T1386S	probably benign	Het
AI661453	T	G	17: 47,466,236	S296A	unknown	Het
Ambp	G	T	4: 63,144,197	N268K	probably damaging	Het
Ankrd11	T	C	8: 122,887,593	K2503E	probably damaging	Het
Ap1g1	C	A	8: 109,832,735	R221S	possibly damaging	Het
Ap5z1	T	C	5: 142,470,149		probably null	Het
Aspa	A	C	11: 73,322,206	N103K	probably benign	Het
BC049730	T	A	7: 24,714,174	I205N	possibly damaging	Het
Bend7	G	A	2: 4,752,779	V211I	probably benign	Het
Bsn	A	G	9: 108,114,404	M1383T	probably benign	Het
Cad	G	T	5: 31,068,806	V1117F	probably damaging	Het
Cdh2	A	G	18: 16,590,301	L856S	probably damaging	Het
Cdh7	T	A	1: 110,061,108	S247T	probably benign	Het
Ces1b	A	G	8: 93,069,315		probably null	Het
Chd7	T	A	4: 8,751,605	V34E	unknown	Het
Clca3a2	A	T	3: 144,805,766	F623I	probably damaging	Het
Cope	T	G	8: 70,312,803	M217R	probably benign	Het
Crim1	T	A	17: 78,315,555	I394N	possibly damaging	Het
Crnkl1	A	T	2: 145,918,566	I644N	probably damaging	Het
Cry1	G	A	10: 85,146,402	A360V	probably damaging	Het
Ctcfl	A	T	2: 173,118,766	V8D	probably benign	Het
Cyp2d34	G	A	15: 82,616,114	Q475*	probably null	Het
Cyp39a1	T	C	17: 43,746,577	Y436H	probably damaging	Het
Cyp3a25	T	A	5: 145,977,668	Q484L	probably benign	Het
Dnah1	A	G	14: 31,265,014	F3607S	probably damaging	Het
Dnali1	T	A	4: 125,065,530	K23N	possibly damaging	Het
Ecel1	T	C	1: 87,153,330	I313V	probably benign	Het
Ehhadh	C	A	16: 21,777,820	A53S	probably benign	Het
Epcam	T	C	17: 87,646,308	S277P	probably benign	Het
Fbxo10	T	C	4: 45,062,062	I155V	possibly damaging	Het
Fgd6	A	T	10: 94,044,344	K353N	possibly damaging	Het
Glce	A	T	9: 62,060,591	M426K	probably benign	Het
Glmp	A	T	3: 88,326,520	N228I	probably damaging	Het
Gm4787	C	A	12: 81,377,720	V555F	possibly damaging	Het
Gm5114	T	A	7: 39,409,376	H273L	probably benign	Het
Gzmg	T	A	14: 56,157,446	T122S	probably benign	Het
Hace1	T	C	10: 45,700,970	V820A	probably damaging	Het
Igf2r	T	A	17: 12,718,795	D535V	probably damaging	Het
Kcnd3	A	G	3: 105,458,873	M20V	probably benign	Het
Kcnn3	T	G	3: 89,609,703	I473S	possibly damaging	Het
Klhl35	T	A	7: 99,473,239	F94Y	unknown	Het
Kmt2c	C	T	5: 25,281,680	V4712I	possibly damaging	Het
Lepr	A	G	4: 101,782,557	E740G	probably benign	Het
Lmod3	T	C	6: 97,248,299	D187G	probably benign	Het
Lsm3	C	T	6: 91,519,561	H49Y	probably benign	Het
Magi1	T	C	6: 93,697,365	S962G	probably damaging	Het
Man2b1	G	A	8: 85,095,613	R782Q	probably damaging	Het
Mical2	A	T	7: 112,303,767	K148N	probably damaging	Het
Nbeal1	C	T	1: 60,260,272	Q1256*	probably null	Het
Ncam1	G	T	9: 49,564,892	A299D	possibly damaging	Het
Ncapg	A	G	5: 45,681,794	D512G	probably damaging	Het
Nkiras2	A	G	11: 100,624,287	N28D	probably benign	Het
Nprl2	A	C	9: 107,543,061	K53T	probably damaging	Het
Nr4a3	T	A	4: 48,051,510	I88N	probably damaging	Het
Oas3	A	G	5: 120,756,966	I986T	possibly damaging	Het
Olfr809	A	T	10: 129,776,785	L305F	possibly damaging	Het
Pcsk1	A	T	13: 75,099,293	Y187F	possibly damaging	Het
Pgc	A	G	17: 47,728,776	T32A	probably benign	Het
Ranbp2	A	C	10: 58,485,861	D2660A	possibly damaging	Het
Retreg1	A	G	15: 25,843,479	R46G		Het
Rrbp1	C	A	2: 143,956,792	K1100N	probably benign	Het
Rsph10b	A	T	5: 143,967,232	T676S	probably benign	Het
Setdb1	A	T	3: 95,338,599	F672I	probably damaging	Het
Setdb1	T	A	3: 95,347,085	D195V	probably damaging	Het
Slc12a8	A	G	16: 33,625,086	E450G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc25a12	A	T	2: 71,275,189	V667E	unknown	Het
Slc39a3	T	C	10: 81,031,277	T212A	probably benign	Het
Slc45a1	C	T	4: 150,638,309	G373S	possibly damaging	Het
Snx11	G	A	11: 96,772,854	T53M	probably damaging	Het
Snx33	A	G	9: 56,925,340	F482L	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stk32a	C	T	18: 43,315,101	Q382*	probably null	Het
Sun3	C	A	11: 9,023,376	S167I	probably damaging	Het
Sycp2	A	G	2: 178,355,062	L1116P	probably damaging	Het
Trav8d-1	C	T	14: 52,778,827	Q57*	probably null	Het
Trio	C	G	15: 27,749,866	V2250L	probably benign	Het
Unc119b	A	T	5: 115,127,043	I204N	probably damaging	Het
Usp4	A	G	9: 108,378,471	E576G	probably damaging	Het
Uvssa	T	A	5: 33,409,504	L515Q	probably damaging	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Xpo6	G	A	7: 126,169,254	L94F	probably benign	Het
Zbtb11	A	G	16: 56,006,020	K804R	probably damaging	Het
Zfp616	A	G	11: 74,084,068	R479G	probably benign	Het
Zfp661	T	C	2: 127,577,924	T99A	probably benign	Het
Zfp839	A	T	12: 110,855,098	Q115H	probably damaging	Het
Zyg11a	C	T	4: 108,189,568		probably null	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTATGTTATGCAGGGTACATCAC -3'
(R):5'- TTCTAACCTCACTGGGGAGG -3'

Sequencing Primer
(F):5'- TCACCATCACGCACGTGG -3'
(R):5'- TCACTGGGGAGGGACCAAC -3'

Posted On

2020-01-23