Mutagenetix > Incidental Mutation

Incidental Mutation 'R6885:Thbs4'

536809

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6885 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92762869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 539 (D539E)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably damaging
Transcript: ENSMUST00000022213
AA Change: D539E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: D539E

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Meta Mutation Damage Score

0.2180

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,520,109	I1025M	probably benign	Het
Adamtsl5	T	A	10: 80,343,631	T164S	probably benign	Het
Ankar	C	T	1: 72,643,036	A1239T	unknown	Het
Aox4	A	T	1: 58,264,378	S1192C	probably damaging	Het
Atl2	T	C	17: 79,852,553	D68G	probably damaging	Het
Btnl4	T	C	17: 34,472,945	I228V	probably benign	Het
Catsper4	T	C	4: 134,215,149	T231A	probably benign	Het
Ccl12	A	T	11: 82,102,697	T54S	probably damaging	Het
Cntn1	T	C	15: 92,243,099		probably null	Het
Cog5	T	A	12: 31,894,199	D694E	probably damaging	Het
Crat	T	A	2: 30,415,196		probably benign	Het
Crot	T	C	5: 8,973,635	T418A	probably benign	Het
Cubn	G	A	2: 13,318,278	P2826L	probably damaging	Het
Dnah17	A	G	11: 118,090,772	F1698L	possibly damaging	Het
Dock8	T	A	19: 25,147,378	D1019E	possibly damaging	Het
Eps15	A	G	4: 109,309,164	N85D	probably damaging	Het
Exoc1	T	C	5: 76,559,042	S457P	probably damaging	Het
Ext1	G	A	15: 53,101,692	T426I	probably damaging	Het
Fat1	T	C	8: 44,952,452	S747P	possibly damaging	Het
Gas7	A	G	11: 67,683,387	D396G	probably damaging	Het
Gm13023	T	C	4: 143,793,533	C116R	probably damaging	Het
Gm5114	G	T	7: 39,408,156	R680S	probably benign	Het
Gpcpd1	A	T	2: 132,554,074	L94M	possibly damaging	Het
Gse1	C	A	8: 120,229,482		probably benign	Het
Hmgb1	T	C	5: 149,050,661	E26G	probably benign	Het
Incenp	C	T	19: 9,875,132	R714Q	unknown	Het
Krt73	T	C	15: 101,796,398	E351G	probably damaging	Het
Ksr1	A	G	11: 79,047,295		probably null	Het
Lpin2	T	G	17: 71,215,150	S60A	probably damaging	Het
Lrrc71	T	C	3: 87,742,620		probably null	Het
Mafb	A	G	2: 160,366,019	S220P	possibly damaging	Het
Maml3	TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	3: 51,697,579			Het
Mcmbp	T	C	7: 128,725,109		probably null	Het
Olfr1191-ps1	A	G	2: 88,643,597	T277A	probably damaging	Het
Olfr390	A	T	11: 73,787,100	H54L	possibly damaging	Het
Paqr9	T	C	9: 95,560,043	S29P	probably benign	Het
Parm1	A	G	5: 91,594,210	T146A	possibly damaging	Het
Pgm1	T	A	5: 64,103,878	F238L	probably benign	Het
Pigv	A	T	4: 133,665,481	F126Y	probably damaging	Het
Pitx2	T	C	3: 129,218,608	M222T	probably damaging	Het
Plekhg6	T	C	6: 125,378,730	N37S	probably benign	Het
Psme4	A	T	11: 30,834,307	K961*	probably null	Het
Rbpj	T	C	5: 53,653,151	W392R	probably damaging	Het
Reg3a	T	A	6: 78,381,055		probably null	Het
Rfc3	C	T	5: 151,648,284	S85N	probably benign	Het
Rtn3	T	C	19: 7,458,331	T80A	probably benign	Het
Sash1	T	C	10: 8,784,221	T195A	probably damaging	Het
Ska1	A	G	18: 74,206,839	V12A	probably benign	Het
Slc25a1	A	G	16: 17,927,430	V80A	probably benign	Het
Slc26a5	A	T	5: 21,834,344	V217D	probably damaging	Het
Slc46a1	A	G	11: 78,466,979	D286G	probably benign	Het
Spata2l	A	T	8: 123,235,558	L88Q	probably damaging	Het
Sptbn1	T	G	11: 30,138,634	Q876P	probably benign	Het
Tenm2	T	A	11: 36,023,580	I2377F	possibly damaging	Het
Tmem154	T	A	3: 84,692,506	C162S	possibly damaging	Het
Tpcn1	T	C	5: 120,544,437	E502G	probably benign	Het
Traf7	G	A	17: 24,512,292	R257C	probably benign	Het
Tsc22d2	T	C	3: 58,416,208	Y174H	probably damaging	Het
Usp8	A	G	2: 126,752,310	E802G	probably damaging	Het
Vmn1r5	T	C	6: 56,986,057	V239A	possibly damaging	Het
Vmn2r99	T	A	17: 19,380,195	S494T	possibly damaging	Het
Zbtb38	A	G	9: 96,686,464	F856L	probably damaging	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTAGGGTTACTGGGCCAC -3'
(R):5'- GTCCTGTCCCGTCCTAAACATG -3'

Sequencing Primer
(F):5'- TGGGCCACCAGACATAGATCAG -3'
(R):5'- TAAACATGCCTGTCACGAGTG -3'

Posted On

2018-10-18