Incidental Mutation 'R9606:Ttc28'
ID 723868
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Name tetratricopeptide repeat domain 28
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9606 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110879803-111289780 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 111285274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 2058 (R2058Q)
Ref Sequence ENSEMBL: ENSMUSP00000136116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
AlphaFold Q80XJ3
Predicted Effect probably benign
Transcript: ENSMUST00000040111
AA Change: R2058Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: R2058Q

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156290
AA Change: R2027Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: R2027Q

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,967 Y286C probably damaging Het
A530032D15Rik G C 1: 85,097,623 probably null Het
Cacna1c T C 6: 118,610,494 T1657A Het
Ccs A T 19: 4,832,869 D151E probably benign Het
Cfap74 A G 4: 155,424,676 T295A Het
Chmp4c A T 3: 10,367,162 E44V probably damaging Het
Crybg2 A T 4: 134,074,072 K539* probably null Het
Dgkg T C 16: 22,622,261 M1V probably null Het
E2f2 T A 4: 136,184,432 Y251* probably null Het
Fat2 T C 11: 55,289,267 Y1416C probably damaging Het
Fgl2 T C 5: 21,372,993 S93P possibly damaging Het
Hivep3 C T 4: 120,132,589 T2079I probably damaging Het
Igfl3 A C 7: 18,179,995 K90T possibly damaging Het
Lsamp A G 16: 41,888,929 D74G probably benign Het
Mmrn2 C A 14: 34,397,697 T211K possibly damaging Het
Mov10 A T 3: 104,800,348 V570D probably benign Het
Mrc1 A T 2: 14,308,706 Y916F probably benign Het
Myo10 CAGGTATAAAG CAG 15: 25,776,315 probably null Het
Ndc1 T A 4: 107,389,489 C370S probably damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nrcam A T 12: 44,562,457 N455I probably damaging Het
Nrp1 G A 8: 128,502,548 E836K probably benign Het
Olfr1477 A T 19: 13,502,579 K79* probably null Het
Olfr329-ps C T 11: 58,542,927 C196Y probably damaging Het
Olfr812 A T 10: 129,842,756 C95* probably null Het
Olfr915 A G 9: 38,647,324 S67P probably damaging Het
Pcca T C 14: 122,664,305 S287P probably damaging Het
Pitpnm3 T A 11: 72,064,243 T482S probably benign Het
Pld2 C T 11: 70,555,067 R676* probably null Het
Ppm1k T C 6: 57,514,072 Y286C possibly damaging Het
Rb1 T C 14: 73,280,133 N278D probably damaging Het
Sema3g T C 14: 31,221,826 L221P probably damaging Het
Skint2 C T 4: 112,625,950 T184I probably benign Het
Slc38a2 A G 15: 96,693,291 F232S probably damaging Het
Snx6 T C 12: 54,768,026 N170S probably benign Het
Sox9 T A 11: 112,782,590 N2K probably damaging Het
Srpk2 T C 5: 23,524,606 E345G probably benign Het
Tbc1d21 T C 9: 58,361,204 M291V possibly damaging Het
Tekt2 T C 4: 126,324,900 N20S probably benign Het
Tnxb T G 17: 34,695,604 I1888S possibly damaging Het
Tsnaxip1 G A 8: 105,840,053 E174K probably damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ttyh2 T A 11: 114,710,841 D430E probably benign Het
Ubr2 C T 17: 46,934,094 G1669R probably damaging Het
Vcan A T 13: 89,705,372 S490T probably damaging Het
Vmn1r86 T A 7: 13,102,814 D45V probably damaging Het
Wdr12 A G 1: 60,088,067 V143A possibly damaging Het
Zbtb18 T A 1: 177,447,423 Y116* probably null Het
Zdbf2 C T 1: 63,303,377 T305I possibly damaging Het
Zfp384 T A 6: 125,030,839 M244K possibly damaging Het
Zfp423 A T 8: 87,687,967 V1241D probably damaging Het
Zfp574 A G 7: 25,081,215 Y554C probably damaging Het
Zfp616 T C 11: 74,085,394 S830P probably damaging Het
Zfp839 A G 12: 110,868,342 Y677C probably benign Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R0833:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1539:Ttc28 UTSW 5 111100811 missense possibly damaging 0.77
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1566:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4840:Ttc28 UTSW 5 111286081 missense probably damaging 1.00
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5518:Ttc28 UTSW 5 111225928 missense probably benign 0.17
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense possibly damaging 0.96
R7101:Ttc28 UTSW 5 111085092 missense probably damaging 1.00
R7135:Ttc28 UTSW 5 111280007 missense probably damaging 1.00
R7350:Ttc28 UTSW 5 111226037 missense probably damaging 0.97
R7454:Ttc28 UTSW 5 111285484 missense probably benign 0.19
R7461:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7596:Ttc28 UTSW 5 111280124 missense probably damaging 1.00
R7613:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7625:Ttc28 UTSW 5 111285219 missense possibly damaging 0.65
R7648:Ttc28 UTSW 5 111183392 missense possibly damaging 0.52
R7735:Ttc28 UTSW 5 111266678 splice site probably null
R8030:Ttc28 UTSW 5 111286056 missense possibly damaging 0.81
R8205:Ttc28 UTSW 5 111225730 missense possibly damaging 0.95
R8246:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8247:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8269:Ttc28 UTSW 5 111277459 missense probably benign 0.09
R8292:Ttc28 UTSW 5 111223257 missense probably damaging 1.00
R8346:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8356:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8423:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8424:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8426:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8441:Ttc28 UTSW 5 111177641 nonsense probably null
R8494:Ttc28 UTSW 5 111235640 missense probably damaging 0.96
R8508:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8510:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8729:Ttc28 UTSW 5 111235643 critical splice donor site probably null
R8845:Ttc28 UTSW 5 111224175 missense probably benign 0.11
R9003:Ttc28 UTSW 5 111277030 missense probably benign 0.00
R9185:Ttc28 UTSW 5 111223476 missense probably benign 0.03
R9187:Ttc28 UTSW 5 111102036 missense probably damaging 1.00
R9245:Ttc28 UTSW 5 111177659 missense unknown
R9251:Ttc28 UTSW 5 110892832 missense possibly damaging 0.47
R9372:Ttc28 UTSW 5 111183207 missense probably benign 0.25
R9466:Ttc28 UTSW 5 111183029 missense probably damaging 0.99
R9563:Ttc28 UTSW 5 111223226 missense probably benign 0.22
R9691:Ttc28 UTSW 5 111284013 missense probably benign 0.01
R9709:Ttc28 UTSW 5 111285771 missense probably damaging 0.97
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Z1176:Ttc28 UTSW 5 111266566 missense possibly damaging 0.59
Z1177:Ttc28 UTSW 5 111278586 missense probably damaging 1.00
Z1177:Ttc28 UTSW 5 111285739 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACAGTCTGTGTCCAACGCTC -3'
(R):5'- GAGCTGACTGAAAGCCTCACAC -3'

Sequencing Primer
(F):5'- CAACGCTCTGCCCTTGG -3'
(R):5'- AGCCTCACACCACCTGGG -3'
Posted On 2022-09-12