Incidental Mutation 'R0764:Pcgf1'
ID72550
Institutional Source Beutler Lab
Gene Symbol Pcgf1
Ensembl Gene ENSMUSG00000069678
Gene Namepolycomb group ring finger 1
SynonymsNspc1, 2010002K04Rik
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83077869-83080855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83079169 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 2 (C2R)
Ref Sequence ENSEMBL: ENSMUSP00000135291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092614] [ENSMUST00000165164] [ENSMUST00000176027] [ENSMUST00000176089] [ENSMUST00000176100] [ENSMUST00000177177]
Predicted Effect probably damaging
Transcript: ENSMUST00000092614
AA Change: C73R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090277
Gene: ENSMUSG00000069678
AA Change: C73R

DomainStartEndE-ValueType
RING 35 73 6.58e-5 SMART
PDB:4HPM|D 155 243 9e-45 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000165164
AA Change: C85R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130614
Gene: ENSMUSG00000069678
AA Change: C85R

DomainStartEndE-ValueType
RING 47 85 6.58e-5 SMART
Pfam:RAWUL 174 253 9.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176027
AA Change: C2R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135664
Gene: ENSMUSG00000069678
AA Change: C2R

DomainStartEndE-ValueType
PDB:2CKL|A 1 46 2e-13 PDB
PDB:4HPM|D 84 106 1e-5 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000176089
AA Change: C2R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135268
Gene: ENSMUSG00000069678
AA Change: C2R

DomainStartEndE-ValueType
PDB:2CKL|A 1 32 5e-9 PDB
PDB:4HPM|D 33 104 3e-27 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176100
SMART Domains Protein: ENSMUSP00000135882
Gene: ENSMUSG00000069678

DomainStartEndE-ValueType
PDB:2CKL|A 19 52 3e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176372
Predicted Effect probably damaging
Transcript: ENSMUST00000177177
AA Change: C2R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135291
Gene: ENSMUSG00000069678
AA Change: C2R

DomainStartEndE-ValueType
PDB:2CKL|A 1 46 2e-12 PDB
PDB:4HPM|D 84 172 7e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204211
Meta Mutation Damage Score 0.9751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PCGF1 is a mammalian homolog of the Drosophila polycomb group genes, which act as transcriptional repressors to regulate anterior-posterior patterning in early embryonic development (Nunes et al., 2001 [PubMed 11287196]). See also PCGF2 (MIM 600346).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Pcgf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Pcgf1 APN 6 83080625 missense probably damaging 1.00
IGL01432:Pcgf1 APN 6 83078417 missense possibly damaging 0.86
IGL01726:Pcgf1 APN 6 83078886 splice site probably null
IGL03394:Pcgf1 APN 6 83079140 missense probably damaging 1.00
R0513:Pcgf1 UTSW 6 83080574 missense probably damaging 0.99
R1486:Pcgf1 UTSW 6 83079126 missense probably damaging 1.00
R4282:Pcgf1 UTSW 6 83079733 missense probably damaging 1.00
R4283:Pcgf1 UTSW 6 83079733 missense probably damaging 1.00
R4324:Pcgf1 UTSW 6 83079957 critical splice donor site probably null
R4732:Pcgf1 UTSW 6 83079957 critical splice donor site probably benign
R4733:Pcgf1 UTSW 6 83079957 critical splice donor site probably benign
R5569:Pcgf1 UTSW 6 83079705 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAATGAACACATCGTTTGCTGCC -3'
(R):5'- TCAAGGTGCCACCCAGCATTAGAG -3'

Sequencing Primer
(F):5'- AGTGTCTCCACACCTGTGAG -3'
(R):5'- ATTAGAGTCAGGAGGCCCCAC -3'
Posted On2013-09-30