Incidental Mutation 'R9650:Tln1'
ID 727021
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9650 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43531519-43562691 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43545912 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 901 (T901I)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: T901I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: T901I

Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A C 9: 35,909,503 M84L probably benign Het
Abca6 T A 11: 110,180,620 N1469Y probably benign Het
Actl10 T A 2: 154,552,762 N211K probably benign Het
Adam33 C T 2: 131,053,069 V690M possibly damaging Het
Agap2 G A 10: 127,091,784 R1178H unknown Het
Ank2 T A 3: 126,942,180 T3352S unknown Het
BC005537 T A 13: 24,802,139 D7E unknown Het
Bptf T C 11: 107,044,586 M142V probably benign Het
Cox15 A G 19: 43,746,879 Y150H probably benign Het
Cpq A T 15: 33,497,259 I382F possibly damaging Het
Cps1 T C 1: 67,215,477 F1275S Het
Cs T A 10: 128,360,987 M417K probably benign Het
Cyp2b19 G A 7: 26,766,783 R337Q possibly damaging Het
Dmgdh A T 13: 93,708,825 Y442F probably benign Het
Dync2h1 A T 9: 7,174,849 D131E possibly damaging Het
Epb41l2 A G 10: 25,493,597 I605V probably benign Het
Evc G A 5: 37,300,818 P963L probably damaging Het
Evl C A 12: 108,675,439 T160N probably benign Het
Fam76a T C 4: 132,902,076 Y255C probably damaging Het
Fras1 G T 5: 96,762,528 R3272L probably damaging Het
Fry T C 5: 150,445,910 V2283A probably damaging Het
Fzd6 A G 15: 39,031,546 Y369C probably damaging Het
Gm4951 T G 18: 60,246,398 V335G probably damaging Het
Hip1r T C 5: 123,997,294 probably null Het
Hps5 A G 7: 46,775,930 S449P probably damaging Het
Ighv1-34 G T 12: 114,851,265 D92E possibly damaging Het
Ino80 C T 2: 119,446,983 R337Q probably damaging Het
Itgax T C 7: 128,135,763 I422T probably benign Het
Itk A T 11: 46,331,951 Y564N probably damaging Het
Kcnh5 A C 12: 74,976,519 S592A probably benign Het
Klhl40 T A 9: 121,780,017 V416E possibly damaging Het
Lhfpl4 T C 6: 113,194,186 E13G probably benign Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Muc16 A T 9: 18,642,466 M4177K unknown Het
Ngef T A 1: 87,487,830 T371S possibly damaging Het
Nutm2 A T 13: 50,469,719 T151S probably benign Het
Olfr1214 A T 2: 88,987,662 L180* probably null Het
Olfr568 T C 7: 102,877,780 I220T probably damaging Het
Pcdhga8 T A 18: 37,727,466 I525K probably benign Het
Pcx C T 19: 4,607,686 R394C probably damaging Het
Pnmt A T 11: 98,387,436 D112V probably damaging Het
Rnf115 C T 3: 96,758,021 T69I probably damaging Het
Rrp7a A T 15: 83,119,890 probably null Het
Senp1 A T 15: 98,048,367 M499K probably damaging Het
Serpina3f G A 12: 104,220,260 A362T possibly damaging Het
Slc29a3 T A 10: 60,750,523 I55F possibly damaging Het
Stab2 ACC AC 10: 86,856,697 probably null Het
Tmem102 T C 11: 69,805,043 K64R probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tnxb G A 17: 34,711,655 V2105I probably damaging Het
Traf2 A C 2: 25,520,442 C391W probably damaging Het
Tubgcp3 A G 8: 12,655,974 S183P probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Usp2 C A 9: 44,089,179 N288K probably damaging Het
Utrn T C 10: 12,738,185 T381A probably benign Het
Vil1 C T 1: 74,425,616 P474L probably benign Het
Wasf2 T A 4: 133,190,146 N185K unknown Het
Zfp865 A G 7: 5,034,684 M45V unknown Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 splice site probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7874:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7874:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R8030:Tln1 UTSW 4 43535737 critical splice donor site probably null
R8105:Tln1 UTSW 4 43538231 missense probably benign 0.32
R8212:Tln1 UTSW 4 43555918 missense probably damaging 1.00
R8416:Tln1 UTSW 4 43540116 missense probably benign 0.01
R8419:Tln1 UTSW 4 43536397 missense probably damaging 1.00
R8680:Tln1 UTSW 4 43553041 missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43534769 splice site probably benign
R8725:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43556383 missense probably benign
R8865:Tln1 UTSW 4 43538281 missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43549786 nonsense probably null
R9050:Tln1 UTSW 4 43549786 nonsense probably null
R9145:Tln1 UTSW 4 43536024 missense probably damaging 1.00
R9210:Tln1 UTSW 4 43536119 missense probably damaging 1.00
R9337:Tln1 UTSW 4 43532927 missense probably damaging 1.00
R9346:Tln1 UTSW 4 43546895 missense probably damaging 0.97
R9358:Tln1 UTSW 4 43532084 missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43542893 missense probably damaging 1.00
R9631:Tln1 UTSW 4 43545694 missense probably damaging 1.00
R9666:Tln1 UTSW 4 43542957 missense probably damaging 0.96
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Z1176:Tln1 UTSW 4 43543211 missense probably benign 0.31
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2022-10-06