Mutagenetix > Incidental Mutation

Incidental Mutation 'R8212:Tln1'

636202

Institutional Source

Beutler Lab

Gene Symbol

Tln1

Ensembl Gene

ENSMUSG00000028465

Gene Name

talin 1

Synonyms

MMRRC Submission

067635-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43531513-43562583 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43555918 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 99 (T99A)

Ref Sequence

ENSEMBL: ENSMUSP00000030187 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]

AlphaFold

P26039

PDB Structure

Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<

Predicted Effect

probably damaging
Transcript: ENSMUST00000030187
AA Change: T99A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: T99A

Domain	Start	End	E-Value	Type
Blast:B41	2	76	5e-31	BLAST
B41	82	313	4.66e-73	SMART
IRS	308	401	7.65e-16	SMART
Pfam:Talin_middle	491	652	8.2e-60	PFAM
low complexity region	671	690	N/A	INTRINSIC
internal_repeat_2	699	760	8.94e-6	PROSPERO
low complexity region	766	775	N/A	INTRINSIC
PDB:1ZVZ\|B	820	844	2e-7	PDB
low complexity region	866	879	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
PDB:2LQG\|A	913	1044	2e-44	PDB
PDB:2L7N\|A	1046	1207	1e-101	PDB
Pfam:VBS	1234	1358	9.6e-8	PFAM
internal_repeat_2	1488	1549	8.94e-6	PROSPERO
internal_repeat_3	1623	1769	4.92e-5	PROSPERO
low complexity region	1817	1828	N/A	INTRINSIC
Pfam:VBS	1849	1973	6.2e-67	PFAM
PDB:3DYJ\|B	1974	2293	N/A	PDB
low complexity region	2305	2327	N/A	INTRINSIC
ILWEQ	2336	2533	2.93e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125509

SMART Domains

Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

Domain	Start	End	E-Value	Type
Blast:IRS	2	28	2e-9	BLAST
PDB:2G35\|A	2	29	3e-11	PDB
Pfam:Talin_middle	32	193	1.8e-61	PFAM
PDB:2L7A\|A	215	279	1e-38	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000130353
AA Change: T99A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465
AA Change: T99A

Domain	Start	End	E-Value	Type
Blast:B41	1	39	9e-7	BLAST
B41	82	241	6.58e-9	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	C	13: 81,670,240 (GRCm39)	I2369V	probably benign	Het
Ager	G	A	17: 34,819,586 (GRCm39)	R368H	possibly damaging	Het
Arl2	G	T	19: 6,187,596 (GRCm39)	T84K	probably damaging	Het
Cfap126	A	T	1: 170,953,630 (GRCm39)	T67S	probably damaging	Het
Cfap45	A	G	1: 172,369,067 (GRCm39)		probably null	Het
Cfdp1	A	T	8: 112,571,815 (GRCm39)	N31K	probably damaging	Het
Clpx	A	G	9: 65,228,173 (GRCm39)	T408A	possibly damaging	Het
Cobll1	T	C	2: 64,932,424 (GRCm39)	N526S	probably benign	Het
Cpne1	T	C	2: 155,920,134 (GRCm39)	D215G	probably damaging	Het
Cstf1	T	C	2: 172,219,872 (GRCm39)	S328P	probably damaging	Het
Cyp2a22	T	C	7: 26,637,205 (GRCm39)	E193G	possibly damaging	Het
Fam83c	A	G	2: 155,671,207 (GRCm39)	F743L	probably benign	Het
Fn1	A	G	1: 71,682,064 (GRCm39)	I364T	probably benign	Het
Foxo3	T	C	10: 42,072,991 (GRCm39)	M509V	possibly damaging	Het
Galnt6	T	C	15: 100,591,308 (GRCm39)	T599A	probably benign	Het
Gm5114	A	G	7: 39,060,676 (GRCm39)	S58P	probably benign	Het
Gria4	G	A	9: 4,480,242 (GRCm39)	A402V	probably benign	Het
Heatr5a	C	A	12: 51,946,012 (GRCm39)	A1200S	probably benign	Het
Nlrp5	A	T	7: 23,116,762 (GRCm39)	D162V	probably benign	Het
Or14j6	T	C	17: 38,215,148 (GRCm39)	V237A	probably benign	Het
Or8b54	G	A	9: 38,686,577 (GRCm39)	V9M	noncoding transcript	Het
Pcf11	G	A	7: 92,308,706 (GRCm39)	R589C	probably damaging	Het
Pkhd1l1	A	G	15: 44,362,696 (GRCm39)	D574G	probably benign	Het
Plb1	T	C	5: 32,422,250 (GRCm39)	S68P	probably damaging	Het
Plekhs1	A	G	19: 56,460,188 (GRCm39)	M95V	probably damaging	Het
Polr2h	T	C	16: 20,536,746 (GRCm39)		probably null	Het
Ppef2	T	A	5: 92,376,524 (GRCm39)	I668L	possibly damaging	Het
Rbm46	C	T	3: 82,772,775 (GRCm39)	R119Q	probably benign	Het
Rwdd1	A	G	10: 33,878,523 (GRCm39)	V104A	probably damaging	Het
Slc2a9	G	T	5: 38,637,402 (GRCm39)	H25N	probably benign	Het
Slc36a3	T	A	11: 55,015,907 (GRCm39)	I416F	probably damaging	Het
Sppl2b	T	A	10: 80,701,193 (GRCm39)	V356D	probably damaging	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638 (GRCm39)		probably benign	Het
Tm9sf3	A	T	19: 41,229,074 (GRCm39)	M243K	probably damaging	Het
Trnt1	T	C	6: 106,746,832 (GRCm39)	Y6H	probably benign	Het
Ttn	T	A	2: 76,612,626 (GRCm39)	H17151L	probably benign	Het
Ube2o	A	G	11: 116,439,624 (GRCm39)	V182A	possibly damaging	Het
Zfhx2	G	T	14: 55,310,373 (GRCm39)	D724E	possibly damaging	Het
Zfp616	T	A	11: 73,976,569 (GRCm39)	V946D	probably damaging	Het

Other mutations in Tln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Tln1	APN	4	43,542,719 (GRCm39)	missense	probably benign	0.22
IGL00987:Tln1	APN	4	43,551,297 (GRCm39)	unclassified	probably benign
IGL01345:Tln1	APN	4	43,536,281 (GRCm39)	missense	probably damaging	1.00
IGL01456:Tln1	APN	4	43,543,432 (GRCm39)	unclassified	probably benign
IGL01715:Tln1	APN	4	43,555,890 (GRCm39)	missense	probably damaging	1.00
IGL01750:Tln1	APN	4	43,545,435 (GRCm39)	missense	probably damaging	1.00
IGL01933:Tln1	APN	4	43,555,894 (GRCm39)	missense	possibly damaging	0.52
IGL01933:Tln1	APN	4	43,539,508 (GRCm39)	missense	probably benign
IGL02119:Tln1	APN	4	43,546,760 (GRCm39)	missense	probably damaging	0.99
IGL02148:Tln1	APN	4	43,555,388 (GRCm39)	missense	probably damaging	1.00
IGL02153:Tln1	APN	4	43,546,857 (GRCm39)	missense	possibly damaging	0.76
IGL02522:Tln1	APN	4	43,540,612 (GRCm39)	missense	probably benign	0.07
IGL02691:Tln1	APN	4	43,539,544 (GRCm39)	missense	probably benign	0.42
IGL02882:Tln1	APN	4	43,539,522 (GRCm39)	missense	probably benign	0.45
IGL02892:Tln1	APN	4	43,555,679 (GRCm39)	missense	probably damaging	1.00
IGL03061:Tln1	APN	4	43,545,694 (GRCm39)	missense	probably damaging	1.00
IGL03102:Tln1	APN	4	43,532,861 (GRCm39)	missense	possibly damaging	0.89
IGL03183:Tln1	APN	4	43,539,084 (GRCm39)	splice site	probably benign
H8786:Tln1	UTSW	4	43,544,589 (GRCm39)	missense	probably damaging	0.97
PIT4576001:Tln1	UTSW	4	43,539,998 (GRCm39)	missense	probably damaging	1.00
PIT4696001:Tln1	UTSW	4	43,542,701 (GRCm39)	critical splice donor site	probably null
R0206:Tln1	UTSW	4	43,549,151 (GRCm39)	missense	probably damaging	1.00
R0208:Tln1	UTSW	4	43,549,151 (GRCm39)	missense	probably damaging	1.00
R0454:Tln1	UTSW	4	43,553,504 (GRCm39)	missense	probably benign
R0539:Tln1	UTSW	4	43,543,434 (GRCm39)	critical splice donor site	probably null
R0548:Tln1	UTSW	4	43,542,709 (GRCm39)	missense	possibly damaging	0.79
R0561:Tln1	UTSW	4	43,550,304 (GRCm39)	missense	possibly damaging	0.94
R0606:Tln1	UTSW	4	43,547,756 (GRCm39)	missense	probably benign	0.34
R0607:Tln1	UTSW	4	43,553,071 (GRCm39)	missense	probably damaging	1.00
R0609:Tln1	UTSW	4	43,544,645 (GRCm39)	missense	possibly damaging	0.63
R0847:Tln1	UTSW	4	43,555,333 (GRCm39)	missense	probably damaging	1.00
R0993:Tln1	UTSW	4	43,549,825 (GRCm39)	missense	probably benign	0.22
R1255:Tln1	UTSW	4	43,538,044 (GRCm39)	missense	probably damaging	1.00
R1292:Tln1	UTSW	4	43,534,578 (GRCm39)	critical splice donor site	probably null
R1752:Tln1	UTSW	4	43,536,311 (GRCm39)	missense	probably damaging	1.00
R2169:Tln1	UTSW	4	43,548,005 (GRCm39)	missense	probably damaging	1.00
R2172:Tln1	UTSW	4	43,545,721 (GRCm39)	missense	probably benign
R2202:Tln1	UTSW	4	43,553,083 (GRCm39)	splice site	probably null
R2680:Tln1	UTSW	4	43,539,668 (GRCm39)	missense	probably damaging	1.00
R3012:Tln1	UTSW	4	43,542,525 (GRCm39)	missense	probably benign
R3714:Tln1	UTSW	4	43,540,597 (GRCm39)	missense	probably damaging	1.00
R3735:Tln1	UTSW	4	43,549,370 (GRCm39)	missense	probably damaging	0.97
R3794:Tln1	UTSW	4	43,536,295 (GRCm39)	missense	probably damaging	1.00
R3825:Tln1	UTSW	4	43,536,413 (GRCm39)	splice site	probably benign
R3983:Tln1	UTSW	4	43,553,030 (GRCm39)	missense	probably damaging	1.00
R4061:Tln1	UTSW	4	43,549,177 (GRCm39)	missense	probably damaging	1.00
R4249:Tln1	UTSW	4	43,536,104 (GRCm39)	missense	probably damaging	1.00
R4287:Tln1	UTSW	4	43,543,509 (GRCm39)	missense	probably benign	0.01
R4471:Tln1	UTSW	4	43,551,018 (GRCm39)	missense	probably benign	0.03
R4562:Tln1	UTSW	4	43,533,598 (GRCm39)	missense	probably damaging	1.00
R4654:Tln1	UTSW	4	43,535,954 (GRCm39)	missense	probably null	1.00
R4737:Tln1	UTSW	4	43,540,588 (GRCm39)	missense	probably benign	0.00
R4936:Tln1	UTSW	4	43,547,522 (GRCm39)	missense	possibly damaging	0.83
R5225:Tln1	UTSW	4	43,539,406 (GRCm39)	missense	probably benign	0.06
R5288:Tln1	UTSW	4	43,540,661 (GRCm39)	missense	probably benign	0.06
R5421:Tln1	UTSW	4	43,533,609 (GRCm39)	missense	possibly damaging	0.80
R5445:Tln1	UTSW	4	43,543,905 (GRCm39)	missense	probably benign	0.26
R5660:Tln1	UTSW	4	43,547,732 (GRCm39)	missense	probably damaging	1.00
R5772:Tln1	UTSW	4	43,545,191 (GRCm39)	missense	probably benign	0.13
R6012:Tln1	UTSW	4	43,539,508 (GRCm39)	missense	probably benign
R6038:Tln1	UTSW	4	43,555,052 (GRCm39)	missense	probably damaging	0.99
R6038:Tln1	UTSW	4	43,555,052 (GRCm39)	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43,555,052 (GRCm39)	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43,555,052 (GRCm39)	missense	probably damaging	0.99
R6052:Tln1	UTSW	4	43,555,052 (GRCm39)	missense	probably damaging	0.99
R6145:Tln1	UTSW	4	43,538,030 (GRCm39)	missense	possibly damaging	0.64
R6157:Tln1	UTSW	4	43,534,744 (GRCm39)	missense	probably benign	0.06
R6242:Tln1	UTSW	4	43,533,145 (GRCm39)	missense	probably damaging	1.00
R6454:Tln1	UTSW	4	43,533,866 (GRCm39)	missense	probably damaging	0.99
R6467:Tln1	UTSW	4	43,543,165 (GRCm39)	missense	probably benign	0.42
R6548:Tln1	UTSW	4	43,547,525 (GRCm39)	missense	probably damaging	0.98
R6576:Tln1	UTSW	4	43,555,419 (GRCm39)	splice site	probably null
R6722:Tln1	UTSW	4	43,547,618 (GRCm39)	missense	probably damaging	1.00
R6968:Tln1	UTSW	4	43,550,217 (GRCm39)	missense	probably benign	0.02
R7000:Tln1	UTSW	4	43,556,302 (GRCm39)	missense	probably damaging	0.96
R7137:Tln1	UTSW	4	43,540,616 (GRCm39)	missense	probably damaging	1.00
R7242:Tln1	UTSW	4	43,542,602 (GRCm39)	missense	probably benign	0.01
R7294:Tln1	UTSW	4	43,534,399 (GRCm39)	missense	probably benign	0.02
R7312:Tln1	UTSW	4	43,545,922 (GRCm39)	missense	probably damaging	1.00
R7547:Tln1	UTSW	4	43,545,206 (GRCm39)	missense	possibly damaging	0.80
R7836:Tln1	UTSW	4	43,554,309 (GRCm39)	missense	probably benign	0.01
R7874:Tln1	UTSW	4	43,555,606 (GRCm39)	missense	probably damaging	1.00
R7874:Tln1	UTSW	4	43,538,041 (GRCm39)	missense	probably damaging	1.00
R8030:Tln1	UTSW	4	43,535,737 (GRCm39)	critical splice donor site	probably null
R8105:Tln1	UTSW	4	43,538,231 (GRCm39)	missense	probably benign	0.32
R8416:Tln1	UTSW	4	43,540,116 (GRCm39)	missense	probably benign	0.01
R8419:Tln1	UTSW	4	43,536,397 (GRCm39)	missense	probably damaging	1.00
R8680:Tln1	UTSW	4	43,553,041 (GRCm39)	missense	possibly damaging	0.52
R8708:Tln1	UTSW	4	43,534,769 (GRCm39)	splice site	probably benign
R8725:Tln1	UTSW	4	43,555,911 (GRCm39)	missense	possibly damaging	0.94
R8727:Tln1	UTSW	4	43,555,911 (GRCm39)	missense	possibly damaging	0.94
R8830:Tln1	UTSW	4	43,556,383 (GRCm39)	missense	probably benign
R8865:Tln1	UTSW	4	43,538,281 (GRCm39)	missense	possibly damaging	0.93
R9049:Tln1	UTSW	4	43,549,786 (GRCm39)	nonsense	probably null
R9050:Tln1	UTSW	4	43,549,786 (GRCm39)	nonsense	probably null
R9145:Tln1	UTSW	4	43,536,024 (GRCm39)	missense	probably damaging	1.00
R9210:Tln1	UTSW	4	43,536,119 (GRCm39)	missense	probably damaging	1.00
R9337:Tln1	UTSW	4	43,532,927 (GRCm39)	missense	probably damaging	1.00
R9346:Tln1	UTSW	4	43,546,895 (GRCm39)	missense	probably damaging	0.97
R9358:Tln1	UTSW	4	43,532,084 (GRCm39)	missense	possibly damaging	0.68
R9487:Tln1	UTSW	4	43,542,893 (GRCm39)	missense	probably damaging	1.00
R9631:Tln1	UTSW	4	43,545,694 (GRCm39)	missense	probably damaging	1.00
R9650:Tln1	UTSW	4	43,545,912 (GRCm39)	missense	probably damaging	1.00
R9666:Tln1	UTSW	4	43,542,957 (GRCm39)	missense	probably damaging	0.96
RF021:Tln1	UTSW	4	43,555,890 (GRCm39)	missense	probably damaging	1.00
X0052:Tln1	UTSW	4	43,533,125 (GRCm39)	critical splice donor site	probably null
X0063:Tln1	UTSW	4	43,548,015 (GRCm39)	nonsense	probably null
Z1176:Tln1	UTSW	4	43,543,211 (GRCm39)	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TCGAACCAGTGAATACTCATCATG -3'
(R):5'- GGTTTTCTGACACAGGCAGC -3'

Sequencing Primer
(F):5'- CCAGTGAATACTCATCATGGTTGG -3'
(R):5'- TTTTCTGACACAGGCAGCCAAAC -3'

Posted On

2020-07-13