Incidental Mutation 'R9631:Tln1'
ID 725486
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9631 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43531519-43562691 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43545694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 928 (A928V)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: A928V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: A928V

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,482,185 D152G Het
Atl3 A G 19: 7,532,188 N427S probably benign Het
Bcar3 T A 3: 122,508,152 D165E possibly damaging Het
Brap T C 5: 121,684,372 I437T probably benign Het
Bspry T C 4: 62,482,718 probably null Het
Camkv G T 9: 107,945,791 V77L probably benign Het
Capn15 A T 17: 25,963,435 D566E probably damaging Het
Ccar2 A G 14: 70,151,895 V76A probably damaging Het
Ccdc142 T C 6: 83,107,161 C516R probably benign Het
Ccdc92b T A 11: 74,630,019 V49E Het
Ccr7 A G 11: 99,145,790 V102A probably benign Het
Cdh23 A T 10: 60,407,389 V1069E possibly damaging Het
Clpb T G 7: 101,785,398 V467G possibly damaging Het
Crebzf T A 7: 90,443,805 L264Q probably damaging Het
Ctif A G 18: 75,471,954 F505L probably benign Het
Cyp2j5 A G 4: 96,641,285 I283T probably benign Het
Ddx39 C A 8: 83,721,100 H191Q possibly damaging Het
Dnajc9 A T 14: 20,388,602 probably null Het
Dock7 A G 4: 98,966,323 L1568P unknown Het
Dpp10 T C 1: 123,341,703 Y659C probably damaging Het
Eef1akmt3 A G 10: 127,041,292 F35L probably benign Het
Etl4 A T 2: 20,661,938 N52I probably benign Het
F5 T A 1: 164,186,854 C565S probably damaging Het
Fam170b T C 14: 32,835,684 S159P probably damaging Het
Fitm2 A G 2: 163,469,837 I152T probably damaging Het
Fn1 T C 1: 71,586,228 D2473G probably benign Het
Fzd2 C A 11: 102,606,090 D453E probably benign Het
Grm5 T C 7: 87,975,352 Y376H probably damaging Het
H2-Q6 T A 17: 35,425,316 H91Q probably benign Het
Hspa4 A T 11: 53,269,755 V498E possibly damaging Het
Igsf10 A T 3: 59,330,483 L759H probably damaging Het
Jph1 T C 1: 17,091,383 T352A probably damaging Het
Kit C T 5: 75,607,029 T24M possibly damaging Het
Krtap28-13 T G 1: 83,061,176 C61G unknown Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mccc1 C A 3: 35,960,036 E711* probably null Het
Mroh2b C T 15: 4,917,074 T452I probably damaging Het
Ms4a10 G A 19: 10,967,087 T111I probably damaging Het
Myh11 A T 16: 14,207,577 V1443E Het
Oc90 A G 15: 65,897,780 L76P probably damaging Het
Olfr1223 T C 2: 89,145,178 probably benign Het
Olfr1308 A G 2: 111,961,032 F14L probably benign Het
Olfr1447 A G 19: 12,901,138 V214A possibly damaging Het
Olfr250 G A 9: 38,368,418 V281M possibly damaging Het
Olfr682-ps1 A T 7: 105,126,400 I290N probably damaging Het
Olfr958 G A 9: 39,550,212 R220* probably null Het
Olfr965 A T 9: 39,719,865 T213S possibly damaging Het
Olfr983 A G 9: 40,092,927 V13A probably damaging Het
Pgr C A 9: 8,900,846 Q127K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rfc1 C T 5: 65,272,508 V852M probably damaging Het
Rin2 T A 2: 145,876,517 L639H probably damaging Het
Rpap2 T A 5: 107,620,426 W377R probably damaging Het
Senp7 T C 16: 56,155,268 S446P probably benign Het
Sipa1l1 A G 12: 82,341,002 M1V probably null Het
Slc25a36 A C 9: 97,100,100 S61A probably benign Het
Sptbn2 C T 19: 4,738,190 R1066W probably damaging Het
Tgm6 A G 2: 130,135,890 S50G probably benign Het
Thada T C 17: 84,231,156 S1475G probably benign Het
Trip11 G A 12: 101,893,548 L357F probably benign Het
Ttc3 G T 16: 94,370,722 probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Vmn1r237 A T 17: 21,314,398 I128F probably benign Het
Vmn2r50 A T 7: 10,053,063 L39* probably null Het
Vps4b A G 1: 106,780,105 V216A possibly damaging Het
Zfp217 T C 2: 170,114,870 N736S possibly damaging Het
Zfp985 A G 4: 147,581,285 E25G probably damaging Het
Zfr C T 15: 12,154,542 R604* probably null Het
Zscan18 A G 7: 12,771,730 S577P possibly damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 splice site probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7874:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7874:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R8030:Tln1 UTSW 4 43535737 critical splice donor site probably null
R8105:Tln1 UTSW 4 43538231 missense probably benign 0.32
R8212:Tln1 UTSW 4 43555918 missense probably damaging 1.00
R8416:Tln1 UTSW 4 43540116 missense probably benign 0.01
R8419:Tln1 UTSW 4 43536397 missense probably damaging 1.00
R8680:Tln1 UTSW 4 43553041 missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43534769 splice site probably benign
R8725:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43556383 missense probably benign
R8865:Tln1 UTSW 4 43538281 missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43549786 nonsense probably null
R9050:Tln1 UTSW 4 43549786 nonsense probably null
R9145:Tln1 UTSW 4 43536024 missense probably damaging 1.00
R9210:Tln1 UTSW 4 43536119 missense probably damaging 1.00
R9337:Tln1 UTSW 4 43532927 missense probably damaging 1.00
R9346:Tln1 UTSW 4 43546895 missense probably damaging 0.97
R9358:Tln1 UTSW 4 43532084 missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43542893 missense probably damaging 1.00
R9650:Tln1 UTSW 4 43545912 missense probably damaging 1.00
R9666:Tln1 UTSW 4 43542957 missense probably damaging 0.96
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Z1176:Tln1 UTSW 4 43543211 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGCTTGACTTCCTCGGACAC -3'
(R):5'- CCATCAAGAAGAAGTTGGTGC -3'

Sequencing Primer
(F):5'- AGCAACGGAATCTGCTCTG -3'
(R):5'- AGAAGTTGGTGCAGCGCC -3'
Posted On 2022-09-12